RNA id: TU1559068



Basic Information


Item Value
RNA id TU1559068
length 236
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G1364313
representative True

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 31946321 ~ 31946556 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccacttccataaaggccagatttgtgcaatatacgacagattgttgtcctatggac

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1558863 lncRNA downstream 23938 31920896 ~ 31922383 (-) True G1364124
TU1558860 lncRNA downstream 26961 31913091 ~ 31919360 (-) True G1364123
TU1558854 lncRNA downstream 38831 31901494 ~ 31907490 (-) True G1364117
TU1558855 lncRNA downstream 43011 31899840 ~ 31903310 (-) True G1364118
TU1558848 lncRNA downstream 52355 31886501 ~ 31893966 (-) True G1364116
TU1559112 lncRNA upstream 70857 32017413 ~ 32017647 (-) True G1364347
TU1559122 lncRNA upstream 85338 32031894 ~ 32032230 (-) True G1364357
TU1559123 lncRNA upstream 85795 32032351 ~ 32032690 (-) True G1364358
TU1559131 lncRNA upstream 98035 32044591 ~ 32045093 (-) True G1364366
TU1559106 lncRNA upstream 108053 32054609 ~ 32056554 (-) True G1364341
XM_021565602.2 mRNA downstream 217378 31712301 ~ 31728943 (-) True si:ch211-28p3.4
XM_036946722.1 mRNA downstream 217397 31712301 ~ 31728924 (-) False si:ch211-28p3.4
XM_036946721.1 mRNA downstream 217398 31712301 ~ 31728923 (-) False si:ch211-28p3.4
XR_005036505.1 mRNA downstream 450021 31475320 ~ 31496300 (-) True LOC110491813
XM_036946719.1 mRNA downstream 450053 31474791 ~ 31496268 (-) False LOC110491813
XM_021565604.2 mRNA upstream 3963 31950519 ~ 31958001 (-) False ttc34
XM_021565603.2 mRNA upstream 3963 31950519 ~ 31958002 (-) True ttc34
XM_036946723.1 mRNA upstream 20166 31966722 ~ 31989796 (-) False LOC110491820
XM_021565608.2 mRNA upstream 20443 31966999 ~ 31989783 (-) True LOC110491820
XM_021565612.2 mRNA upstream 110392 32056948 ~ 32096133 (-) True LOC110491822
TU1558829 other downstream 60209 31885749 ~ 31886112 (-) True G1364105
TU1558520 other downstream 295624 31639437 ~ 31650697 (-) True G1363836
TU1556170 other downstream 2021167 29923871 ~ 29925154 (-) True G1361619
TU1555797 other downstream 2448766 29497113 ~ 29497555 (-) True G1361290
TU1554186 other downstream 3765381 28177715 ~ 28180940 (-) True taok2b
TU1559113 other upstream 72238 32018794 ~ 32019498 (-) True G1364348
TU1559908 other upstream 687909 32634465 ~ 32635511 (-) False G1365099
TU1559909 other upstream 688007 32634563 ~ 32635511 (-) True G1365099
TU1561599 other upstream 1737455 33684011 ~ 33684473 (-) True G1366703
TU1561654 other upstream 1800844 33747400 ~ 33751407 (-) True G1366756

Expression Profile


TU1559068 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

TU1559068 Expression in each Bioproject

Bar chart with 19 bars.
TU1559068 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.