RNA id: TU1559112



Basic Information


Item Value
RNA id TU1559112
length 235
lncRNA type inter_gene
GC content 0.55
exon number 1
gene id G1364347
representative True

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 32017413 ~ 32017647 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gagcgagacatgatgtcccagatgtgctcaattggattcaggtctggggaacgggcgggccagtccgtagcatcaatgccttcctcttgcaggaactgctgacacactccagccacatgaggtctagcattgtcttgcattaggaggaatccagggccaaccgcaccagcatatggtctcacaaggggtctgaggatctcatctcggtacctaatggcagtcaggctacctctgg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1559068 lncRNA downstream 70857 31946321 ~ 31946556 (-) True G1364313
TU1558863 lncRNA downstream 95030 31920896 ~ 31922383 (-) True G1364124
TU1558860 lncRNA downstream 98053 31913091 ~ 31919360 (-) True G1364123
TU1558854 lncRNA downstream 109923 31901494 ~ 31907490 (-) True G1364117
TU1558855 lncRNA downstream 114103 31899840 ~ 31903310 (-) True G1364118
TU1559122 lncRNA upstream 14247 32031894 ~ 32032230 (-) True G1364357
TU1559123 lncRNA upstream 14704 32032351 ~ 32032690 (-) True G1364358
TU1559131 lncRNA upstream 26944 32044591 ~ 32045093 (-) True G1364366
TU1559106 lncRNA upstream 36962 32054609 ~ 32056554 (-) True G1364341
TU1559191 lncRNA upstream 121491 32139138 ~ 32191970 (-) True G1364424
XM_036946723.1 mRNA downstream 27617 31966722 ~ 31989796 (-) False LOC110491820
XM_021565608.2 mRNA downstream 27630 31966999 ~ 31989783 (-) True LOC110491820
XM_021565603.2 mRNA downstream 59411 31950519 ~ 31958002 (-) True ttc34
XM_021565604.2 mRNA downstream 59412 31950519 ~ 31958001 (-) False ttc34
XM_021565602.2 mRNA downstream 288470 31712301 ~ 31728943 (-) True si:ch211-28p3.4
XM_021565612.2 mRNA upstream 39301 32056948 ~ 32096133 (-) True LOC110491822
XR_002468909.2 mRNA upstream 64060 32081707 ~ 32086786 (-) True LOC110491823
XM_036946725.1 mRNA upstream 212640 32230287 ~ 32301791 (-) False LOC110491825
XM_021565614.2 mRNA upstream 212640 32230287 ~ 32350851 (-) False LOC110491825
XM_021565616.2 mRNA upstream 212640 32230287 ~ 32350851 (-) False LOC110491825
TU1558829 other downstream 131301 31885749 ~ 31886112 (-) True G1364105
TU1558520 other downstream 366716 31639437 ~ 31650697 (-) True G1363836
TU1556170 other downstream 2092259 29923871 ~ 29925154 (-) True G1361619
TU1555797 other downstream 2519858 29497113 ~ 29497555 (-) True G1361290
TU1554186 other downstream 3836473 28177715 ~ 28180940 (-) True taok2b
TU1559113 other upstream 1147 32018794 ~ 32019498 (-) True G1364348
TU1559908 other upstream 616818 32634465 ~ 32635511 (-) False G1365099
TU1559909 other upstream 616916 32634563 ~ 32635511 (-) True G1365099
TU1561599 other upstream 1666364 33684011 ~ 33684473 (-) True G1366703
TU1561654 other upstream 1729753 33747400 ~ 33751407 (-) True G1366756

Expression Profile


TU1559112 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU1559112 Expression in each Bioproject

Bar chart with 19 bars.
TU1559112 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.