RNA id: TU1580856



Basic Information


Item Value
RNA id TU1580856
length 351
lncRNA type intronic
GC content 0.38
exon number 1
gene id G1384063
representative True

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 50252012 ~ 50252362 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


atttaaccaggtaggctagttgagaacaagttctcatttacaactgcgacctggccaagataaagcaaagcagtgtgaacagacaacaacacagttacacatggagtaaacaataaacaagtcaataacacagtagtaaaaaaaagaaagtctatatacattgtgtgcaaaaggcatgaggaggtaggcaataaataggccataggagcgaataattacaatttagcagattaacactggagtgataaatgatcagatggtcatgtgcaggtagagatactggtgtgcaaaagagcataaaagtaaataaataaaaacagtatggggatgaggtaggtatattgggtgggc

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1580853 lncRNA upstream 1097 50249583 ~ 50250915 (+) True G1384061
TU1580846 lncRNA upstream 11419 50240362 ~ 50240593 (+) True G1384055
TU1580841 lncRNA upstream 20383 50231405 ~ 50231629 (+) True G1384050
TU1580836 lncRNA upstream 28752 50223043 ~ 50223260 (+) True G1384045
TU1580834 lncRNA upstream 30256 50221384 ~ 50221756 (+) True G1384043
TU1580872 lncRNA downstream 42535 50294897 ~ 50295441 (+) True G1384076
TU1580849 lncRNA downstream 61435 50313797 ~ 50314363 (+) True G1384058
TU1580882 lncRNA downstream 76993 50329355 ~ 50329678 (+) True G1384086
TU1580888 lncRNA downstream 83492 50335854 ~ 50336083 (+) True G1384092
TU1580889 lncRNA downstream 84273 50336635 ~ 50336933 (+) True G1384093
XM_021566307.2 mRNA upstream 42815 50121066 ~ 50209197 (+) False LOC100136219
XM_036947165.1 mRNA upstream 42815 50121066 ~ 50209197 (+) False LOC100136219
XM_036947166.1 mRNA upstream 42815 50121066 ~ 50209197 (+) False LOC100136219
XM_036947167.1 mRNA upstream 42815 50159082 ~ 50209197 (+) False LOC100136219
XM_021566305.2 mRNA upstream 236489 49996722 ~ 50015523 (+) False LOC110492206
XM_036947173.1 mRNA downstream 3106 50255468 ~ 50311045 (+) False LOC110492207
XM_036947172.1 mRNA downstream 3149 50255511 ~ 50311045 (+) True LOC110492207
XM_021566310.2 mRNA downstream 71783 50324145 ~ 50326821 (+) True LOC110492209
XM_036947177.1 mRNA downstream 237875 50490237 ~ 50793128 (+) False LOC110492210
XM_036947176.1 mRNA downstream 237876 50490238 ~ 50796195 (+) False LOC110492210
TU1579025 other upstream 1002137 49245582 ~ 49249875 (+) False LOC110492182
TU1578917 other upstream 1217874 49024931 ~ 49034138 (+) False LOC110492179
TU1578916 other upstream 1217874 49025211 ~ 49034138 (+) True LOC110492179
TU1578405 other upstream 1939196 48282210 ~ 48312816 (+) True LOC110492164
TU1576401 other upstream 3222820 47026122 ~ 47029192 (+) True LOC110491080
TU1581021 other downstream 237936 50490298 ~ 50529084 (+) True LOC110492210
TU1581081 other downstream 320330 50572692 ~ 50573050 (+) True G1384247
TU1582637 other downstream 1029041 51281403 ~ 51289259 (+) True nphp4
TU1583194 other downstream 1273651 51526013 ~ 51526813 (+) True G1386227
TU1583221 other downstream 1307791 51560153 ~ 51560878 (+) True G1386254

Expression Profile


TU1580856 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU1580856 Expression in each Bioproject

Bar chart with 19 bars.
TU1580856 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.