RNA id: TU1586973



Basic Information


Item Value
RNA id TU1586973
length 279
lncRNA type inter_gene
GC content 0.46
exon number 1
gene id G1389537
representative True

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 54144807 ~ 54145085 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aggccaaggtatgtatagttttttgtgtgctctacggcaacggtgtctagatggaatttgtatttgtggtcctggcaactggaccttttttggaacaccattatttttgtcttactgagatttactgtcagggcccaggtctgacagaatctgtgcagaagatctaggtgctgctgtaggccctccttgttttgggacagaagcaccagatcatcagcaaacagtagacgtttgacttcagattctagtaaggtcaggccgggtgctgcagactgttct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1586969 lncRNA downstream 3180 54141216 ~ 54141627 (-) True G1389533
TU1586907 lncRNA downstream 4729 54116463 ~ 54140078 (-) True G1389474
TU1586904 lncRNA downstream 29996 54112674 ~ 54114811 (-) False G1389472
TU1586905 lncRNA downstream 29996 54113925 ~ 54114811 (-) True G1389472
TU1586948 lncRNA downstream 48860 54095680 ~ 54095947 (-) True G1389512
TU1586984 lncRNA upstream 18473 54163558 ~ 54168597 (-) False LOC110491105
TU1586985 lncRNA upstream 20375 54165460 ~ 54168972 (-) True LOC110491105
TU1587025 lncRNA upstream 86401 54231486 ~ 54232349 (-) True G1389582
TU1587047 lncRNA upstream 118519 54263604 ~ 54264208 (-) True G1389598
TU1587056 lncRNA upstream 135460 54280545 ~ 54293497 (-) True LOC110492306
XM_036945764.1 mRNA downstream 176672 53958415 ~ 53968135 (-) True commd7
XM_021564407.2 mRNA downstream 176681 53956911 ~ 53968126 (-) False commd7
NM_001165191.2 mRNA downstream 176712 53957921 ~ 53968095 (-) False commd7
XM_036947269.1 mRNA downstream 225460 53776878 ~ 53919347 (-) False LOC110491103
XM_036947268.1 mRNA downstream 225464 53776878 ~ 53919343 (-) False LOC110491103
XM_036947294.1 mRNA upstream 22295 54167380 ~ 54236936 (-) False LOC110491105
XM_036947295.1 mRNA upstream 22295 54167380 ~ 54236936 (-) False LOC110491105
XM_036947296.1 mRNA upstream 22295 54167380 ~ 54236936 (-) False LOC110491105
XM_036947297.1 mRNA upstream 22295 54167380 ~ 54236936 (-) False LOC110491105
XM_036947298.1 mRNA upstream 22295 54167380 ~ 54236936 (-) False LOC110491105
TU1585952 other downstream 411892 53730337 ~ 53732915 (-) True LOC110492299
TU1585503 other downstream 1111886 53031932 ~ 53032921 (-) True G1388236
TU1585247 other downstream 1572500 52571710 ~ 52572307 (-) True LOC110492250
TU1585179 other downstream 1716048 52418876 ~ 52428759 (-) True spen
TU1583828 other downstream 2154812 51983134 ~ 51989995 (-) True LOC110492226
TU1587231 other upstream 399643 54544728 ~ 54545243 (-) True G1389763
TU1587517 other upstream 839733 54984818 ~ 54986263 (-) True G1390030
TU1588497 other upstream 1679074 55824159 ~ 55826631 (-) True LOC110492352
TU1589255 other upstream 1919418 56064503 ~ 56064862 (-) True G1391586
TU1589295 other upstream 2080329 56225414 ~ 56226061 (-) True G1391624

Expression Profile


TU1586973 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

TU1586973 Expression in each Bioproject

Bar chart with 20 bars.
TU1586973 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.