RNA id: TU1587913



Basic Information


Item Value
RNA id TU1587913
length 403
RNA type TUCP
GC content 0.58
exon number 2
gene id G1390376
representative True

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 55351200 ~ 55351729 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


AGCAATCGATGCTGTGTAGGATGGCTTTGTCCAAGCCTAGCGCTTTGCCCTCAAACTGGGTCATGGCAGTCTTCCTGGAGAGGAGTGCTGAGGGAGGCTCCTCCATCTCTGCTCCTCCCATCAGGCAGTCGTTCTGGGAGTGTCCCAGCTCCACATCCTGGCCATGGGCACCACCTCCACGTTCTGAGGGGTCCCCACCCTGGCTGCTCAACTCCCCCTCGAACCCAGGCGGCTTGGGAAGGGATTTACGCTCTGCTGAGGCTTTAGAGGACTGGTCCTGCTTGCTCTGGGTTCCCAGTAGGTAGTGTTCATCATGTGGGTCCTCTGGGTCACCCTGAGATCTGTGCTGCAAGGAGGTCATCTTCTGGCCCACTATTCCAAACGTGGTGGGGTAGAACAAGGC

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1587885 lncRNA upstream 32513 55318477 ~ 55318687 (+) True G1390351
TU1587883 lncRNA upstream 33124 55317827 ~ 55318076 (+) True G1390349
TU1587871 lncRNA upstream 37619 55313295 ~ 55313581 (+) True G1390339
TU1587868 lncRNA upstream 39788 55311165 ~ 55311412 (+) True G1390336
TU1587849 lncRNA upstream 57128 55293752 ~ 55294072 (+) True G1390317
TU1587938 lncRNA downstream 31453 55383182 ~ 55383419 (+) True G1390397
TU1587945 lncRNA downstream 48132 55399861 ~ 55403953 (+) False G1390402
TU1587948 lncRNA downstream 48132 55399861 ~ 55403953 (+) True G1390402
TU1587990 lncRNA downstream 169348 55521077 ~ 55526869 (+) True LOC110492332
TU1587989 lncRNA downstream 175420 55527149 ~ 55527530 (+) True G1390439
XM_036947322.1 mRNA upstream 212097 55072237 ~ 55139103 (+) True sema3bl
XR_002469098.2 mRNA upstream 358851 54989353 ~ 54992349 (+) True LOC110492913
XM_021566547.2 mRNA upstream 362502 54971324 ~ 54988698 (+) False ifrd2
XM_021566543.2 mRNA upstream 382306 54958795 ~ 54968894 (+) True LOC110492324
XM_036947318.1 mRNA upstream 395473 54944723 ~ 54955727 (+) False hyal3
XM_021566558.2 mRNA downstream 165176 55516905 ~ 55535738 (+) False LOC110492332
XM_021566556.2 mRNA downstream 169302 55521031 ~ 55535738 (+) False LOC110492332
XM_021566557.2 mRNA downstream 169336 55521065 ~ 55535738 (+) False LOC110492332
XM_021566559.2 mRNA downstream 174930 55526659 ~ 55535738 (+) False LOC110492332
XM_021566560.2 mRNA downstream 187577 55539306 ~ 55564300 (+) True LOC110492333
TU1586576 other upstream 568852 54781700 ~ 54782348 (+) False LOC110492320
TU1586323 other upstream 1044292 54306450 ~ 54306908 (+) True G1388919
TU1586321 other upstream 1049042 54299174 ~ 54302158 (+) True G1388917
TU1586186 other upstream 1121339 54163086 ~ 54229861 (+) True G1388806
TU1586172 other upstream 1301458 54046015 ~ 54049742 (+) True LOC110492303
TU1587926 other downstream 12739 55364468 ~ 55381360 (+) False G1390386
TU1587927 other downstream 24010 55375739 ~ 55381360 (+) True G1390386
TU1588023 other downstream 176864 55528593 ~ 55529648 (+) True G1390473
TU1588061 other downstream 276965 55628694 ~ 55632838 (+) True G1390508
TU1588081 other downstream 288293 55640022 ~ 55640299 (+) True G1390527

Expression Profile


TU1587913 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU1587913 Expression in each Bioproject

Bar chart with 9 bars.
TU1587913 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.