RNA id: TU1591335



Basic Information


Item Value
RNA id TU1591335
length 266
lncRNA type inter_gene
GC content 0.48
exon number 2
gene id G1393509
representative True

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 58238851 ~ 58239360 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tatgtgtcggggggctggggtcagtttgctatatctggagtacttctcctgtcttattcggtgtcctgtgtgaatctaagtgtgcgttctctccttctctctttctttctttctttctctctctcggaggacctgagccctaggaccatgccccaggaatacctgacatgatgactccttgctgtccccagtcaacctgaccgtgctgctgctccagtttaaactgttctgccttattattattcgaccatgctggtcatttatga

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1591326 lncRNA upstream 19557 58219061 ~ 58219294 (+) True G1393500
TU1591322 lncRNA upstream 23016 58215589 ~ 58215835 (+) True G1393496
TU1591269 lncRNA upstream 69355 58168811 ~ 58169496 (+) True G1393453
TU1591264 lncRNA upstream 76846 58161320 ~ 58162005 (+) True G1393448
TU1591256 lncRNA upstream 91664 58146962 ~ 58147187 (+) True G1393440
TU1591343 lncRNA downstream 10421 58249781 ~ 58250139 (+) True G1393517
TU1591353 lncRNA downstream 42830 58282190 ~ 58282472 (+) True G1393527
TU1591360 lncRNA downstream 54800 58294160 ~ 58294389 (+) True G1393534
TU1591383 lncRNA downstream 139864 58379224 ~ 58380701 (+) True G1393554
TU1591388 lncRNA downstream 143815 58383175 ~ 58412205 (+) True G1393559
XM_021566699.2 mRNA upstream 31588 58199208 ~ 58207263 (+) True LOC110492406
XM_036947381.1 mRNA upstream 43436 58186526 ~ 58195415 (+) False LOC110492405
XM_036947383.1 mRNA downstream 24005 58263365 ~ 58278453 (+) False LOC110492407
XM_036947384.1 mRNA downstream 27178 58266538 ~ 58278453 (+) True LOC110492407
XR_005036562.1 mRNA downstream 78671 58318031 ~ 58332793 (+) False LOC110492411
XM_021566705.2 mRNA downstream 78674 58318034 ~ 58335164 (+) True LOC110492411
XM_021566706.2 mRNA downstream 108093 58347453 ~ 58363312 (+) True LOC110492412
TU1590331 other upstream 836321 57401485 ~ 57402530 (+) True G1392617
TU1590330 other upstream 841674 57396940 ~ 57397177 (+) True G1392616
TU1590308 other upstream 872334 57365951 ~ 57366517 (+) True G1392601
TU1589153 other upstream 1448170 56780061 ~ 56790681 (+) True LOC118939462
TU1588882 other upstream 1991978 56246515 ~ 56246873 (+) False G1391254
TU1591401 other downstream 180026 58419386 ~ 58423502 (+) True G1393570
TU1591484 other downstream 326776 58566136 ~ 58566794 (+) True G1393647
TU1592862 other downstream 1039759 59279119 ~ 59281099 (+) True LOC110492427
TU1592906 other downstream 1066214 59305574 ~ 59306035 (+) True G1394888
TU1594109 other downstream 2081443 60320803 ~ 60336069 (+) True G1395932

Expression Profile


TU1591335 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

TU1591335 Expression in each Bioproject

Bar chart with 9 bars.
TU1591335 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.