RNA id: XM_036948410.1


Basic Information

Item Value
RNA id XM_036948410.1
length 387
RNA type mRNA
GC content 0.61
exon number 1
gene id LOC118940146
representative True

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 43440766 ~ 43441152 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence

ATGAGCGGAAGAGGCAAAACCGGAGGCAAGGCCAGGGCGAAGGCAAAGACACGTTCATCCCGTGCCGGGCTCCAGTTCCCCGTGGGCCGTGTGCACAGGCTGCTGCGTAAAGGCAACTACGCCGAGCGTGTGGGCGCTGGCGCACCAGTGTACCTGGCCGCAGTGCTCGAGTACCTGACTGCTGAGATCCTGGAGTTGGCCGGAAACGCTGCCCGTGACAACAAGAAGACTCGTATCATCCCCCGTCACCTGCAGCTGGCAGTCCGTAACGACGAGGAGCTGAACAAACTGCTTGGCGGCGTGACCATCGCGCAGGGTGGTGTTCTGCCCAACATCCAGGCAGTGCTGCTCCCCAAGAAGACTGAGAAGGCCGTCAAAGCCAAGTAA

Function

GO:

id name namespace
GO:0006334 nucleosome assembly biological_process
GO:0042742 defense response to bacterium biological_process
GO:0031640 killing of cells of other organism biological_process
GO:0050832 defense response to fungus biological_process
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG:

id description
K11251 H2A; histone H2A

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU1661378 lncRNA upstream 99380 43332567 ~ 43341386 (+) True LOC118940144
TU1661522 lncRNA upstream 113834 43326718 ~ 43326932 (+) True G1452090
TU1661521 lncRNA upstream 114068 43326395 ~ 43326698 (+) True G1452089
TU1661519 lncRNA upstream 119744 43320785 ~ 43321022 (+) True G1452087
TU1661505 lncRNA upstream 121936 43315934 ~ 43318830 (+) True G1452073
TU1661839 lncRNA downstream 56384 43497536 ~ 43497760 (+) True G1452364
TU1661842 lncRNA downstream 58742 43499894 ~ 43505382 (+) False G1452366
TU1661841 lncRNA downstream 63325 43504477 ~ 43517376 (+) True G1452366
TU1661848 lncRNA downstream 67567 43508719 ~ 43552834 (+) False G1452369
TU1661859 lncRNA downstream 67567 43508719 ~ 43562011 (+) False G1452369
XM_036949946.1 mRNA upstream 4028 43436272 ~ 43436738 (+) True LOC118940463
XM_036949949.1 mRNA upstream 4987 43427168 ~ 43435779 (+) True LOC110493837
XM_036948409.1 mRNA upstream 18951 43420168 ~ 43421815 (+) True LOC118940145
XM_021568346.2 mRNA upstream 45762 43369390 ~ 43395004 (+) True LOC110493838
XM_036949937.1 mRNA upstream 91034 43349063 ~ 43349732 (+) True LOC118940453
XM_036949945.1 mRNA downstream 354 43441506 ~ 43442036 (+) True LOC118940462
XM_036949948.1 mRNA downstream 4769 43445921 ~ 43458256 (+) True LOC118940465
XM_036949943.1 mRNA downstream 9402 43450554 ~ 43452433 (+) True LOC118940460
LOC118940464 mRNA downstream 17591 43458743 ~ 43459203 (+) True LOC118940464
XM_021568531.2 mRNA downstream 498765 43939917 ~ 44074496 (+) False plxnb1b
TU1661374 other upstream 4026 43333515 ~ 43436740 (+) True G1451948
TU1661373 other upstream 12204 43333515 ~ 43428562 (+) False G1451948
TU1661383 other upstream 30950 43329099 ~ 43409816 (+) True G1451956
TU1659721 other upstream 1550251 41792883 ~ 41890515 (+) True G1450387
TU1659644 other upstream 1747048 41642123 ~ 41693718 (+) True LOC110493897
TU1661834 other downstream 41108 43482260 ~ 43483693 (+) True G1452359
TU1661837 other downstream 50022 43491174 ~ 43492068 (+) True G1452362
TU1661856 other downstream 100512 43541664 ~ 43563701 (+) False G1452369
TU1661935 other downstream 165161 43606313 ~ 43606781 (+) True G1452399
TU1662359 other downstream 1071917 44513069 ~ 44520477 (+) True G1452804