RNA id: TU1669107



Basic Information


Item Value
RNA id TU1669107
length 370
lncRNA type sense_over
GC content 0.55
exon number 2
gene id cacna1da
representative True

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 49478916 ~ 49594500 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TAAGCAGCGCTGCATAGCGGGCGAGGATGCTCTGTTCTCCCCCGCATACACTCTCCTGTCTCATGCTTTCCACGATCAACATGGAAGGGCTTTAGTAATGCCCCTGCCCTCAAGCTAATGAATTATAACTCGCCGTTTGAGACTGGACTTGCGTTAAAGCACTGGACTTTCCCTACCGAGTGGATAACGCTGAGGTATCTGCCGAATAATAAGTCTTCGGAAAAGAGGCAAATTATGCCAGCAGCACCAGAGTCCCTCCCTCTGGTGACGTGCCAGCCCATTGGTCAGACCGCCCTGTGCCCCTCATTTAGCCCCGCCCTCTCTCCTGGCAGATCCATGCTGCTGGACACGCCCCACAGAGCCACGCCCA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1669088 lncRNA upstream 2983 49475545 ~ 49475959 (+) True G1458935
TU1669084 lncRNA upstream 7510 49470914 ~ 49471432 (+) True G1458931
TU1669080 lncRNA upstream 9381 49469281 ~ 49469561 (+) True G1458927
TU1669072 lncRNA upstream 12897 49465844 ~ 49466045 (+) True G1458919
TU1668960 lncRNA upstream 33788 49444808 ~ 49445154 (+) True G1458811
TU1669175 lncRNA downstream 99653 49587952 ~ 49588882 (+) True G1458992
TU1669189 lncRNA downstream 176207 49664506 ~ 49664931 (+) True G1458998
TU1669188 lncRNA downstream 178199 49666498 ~ 49667783 (+) True G1458997
TU1669219 lncRNA downstream 180912 49669211 ~ 49669661 (+) False G1459027
TU1669222 lncRNA downstream 180912 49669211 ~ 49669740 (+) True G1459027
XM_021568713.2 mRNA upstream 159325 49309152 ~ 49319617 (+) True LOC110494034
XM_036950022.1 mRNA upstream 358525 49010008 ~ 49120417 (+) False LOC110494028
XR_005036997.1 mRNA upstream 443018 49033962 ~ 49035924 (+) True LOC118940474
XM_021568700.2 mRNA upstream 450617 49010008 ~ 49028325 (+) False LOC110494028
XM_021570293.2 mRNA downstream 116364 49604663 ~ 49657967 (+) True LOC110494954
XM_036948186.1 mRNA downstream 692746 50181045 ~ 50192699 (+) False LOC110494957
XM_021570299.2 mRNA downstream 692751 50181050 ~ 50192699 (+) False LOC110494957
XM_021570327.2 mRNA downstream 708804 50197103 ~ 50207320 (+) True LOC110494976
XM_021570338.2 mRNA downstream 734342 50222641 ~ 50229675 (+) True LOC110494984
TU1668956 other upstream 39613 49439006 ~ 49439329 (+) True G1458807
TU1668189 other upstream 438586 48933340 ~ 49040356 (+) True erc2
TU1668185 other upstream 540920 48928347 ~ 48938022 (+) False erc2
TU1669722 other downstream 692866 50181165 ~ 50183696 (+) True LOC110494957
TU1669855 other downstream 942508 50430807 ~ 50435706 (+) False atxn7l2a
TU1670065 other downstream 1288230 50776529 ~ 50777072 (+) True G1459769
TU1670568 other downstream 1406641 50894940 ~ 50897444 (+) True LOC110494047
TU1670644 other downstream 1591833 51080132 ~ 51090889 (+) False G1460249

Expression Profile


TU1669107 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

TU1669107 Expression in each Bioproject

Bar chart with 4 bars.
TU1669107 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.