RNA id: TU1677370



Basic Information


Item Value
RNA id TU1677370
length 560
lncRNA type sense_over
GC content 0.48
exon number 2
gene id dnai1.2
representative False

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 56130667 ~ 56167366 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


AGGTTCATACCTTTGACCTTAGCATCAACAAATATGAGGCCATCTGCCAGCAGCCGGTGGTGGCCAAGAAAAAGACTAAGCTGACTCACATTGAGTTTAACCCCGTCTACCCCATCATCATCGTGGGAGACGACCGAGGATATGTTACCAGCCTCAAGCTCTCGCCTAACCTGCGCAAAAAACCCAAGGAGAAGAAGGGTCAGGAGCTGCCCAAGGGGCCTGAGGTGGAGATCGCCAAGATGGAGAAGCTGCTGAGTTTACTGCGGGAGCCAGAGAACAGCAATGCTTAGAAACTATGACAACATCATGCAGGACTGTAGTCGCCCACTATTTCTACTACTGCACTCCAGTTATAAACCCACCACCAGTCATGCCTTATTACTACTGTCTTCTGTCTTCTAAAGCTGCATACTAAAGCCACCGTTCCTTCCCATGTTGAAGTATAGTGCGGTCTATTGAATCTGTGCAATCTAGCCTACTGTTTTTCTCACTCTTGCGCTGTGCACTATACTAAACATATAGATAGTCAGTGTGCAACCAGCAACGTCTCCTTTACCTGA

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1677358 lncRNA downstream 18138 56110249 ~ 56112628 (-) True G1466494
TU1677328 lncRNA downstream 52813 56025359 ~ 56077953 (-) True G1466464
TU1677349 lncRNA downstream 55207 56074152 ~ 56075559 (-) True G1466485
TU1677351 lncRNA downstream 62923 56066385 ~ 56067843 (-) True G1466487
TU1677295 lncRNA downstream 179676 55950796 ~ 55951090 (-) True G1466432
TU1678331 lncRNA upstream 109391 56254579 ~ 56254788 (-) True G1467342
TU1678334 lncRNA upstream 118802 56263990 ~ 56264229 (-) True G1467345
TU1678340 lncRNA upstream 125783 56270971 ~ 56271170 (-) True G1467351
TU1678344 lncRNA upstream 134346 56279534 ~ 56279848 (-) True G1467355
TU1678360 lncRNA upstream 157423 56302611 ~ 56302858 (-) True G1467371
XM_021568896.2 mRNA downstream 114668 55989707 ~ 56016098 (-) True LOC110494129
XM_021568897.2 mRNA downstream 132448 55989707 ~ 55998318 (-) False LOC110494129
XM_036950219.1 mRNA downstream 142675 55981511 ~ 55988091 (-) True LOC110494136
XM_036950220.1 mRNA downstream 143972 55981511 ~ 55986794 (-) False LOC110494136
XM_021568907.2 mRNA downstream 159765 55956304 ~ 55971001 (-) False LOC110494137
XM_021568925.2 mRNA upstream 64288 56209476 ~ 56221654 (-) False LOC110494148
XM_021568926.2 mRNA upstream 64288 56209476 ~ 56221659 (-) False LOC110494148
XM_036950226.1 mRNA upstream 64288 56209476 ~ 56221661 (-) False LOC110494148
XM_021568924.2 mRNA upstream 64288 56209476 ~ 56221662 (-) True LOC110494148
XR_005037019.1 mRNA upstream 102898 56248086 ~ 56253169 (-) False pnp4a
TU1677293 other downstream 160052 55954473 ~ 55970714 (-) True LOC110494137
TU1675710 other downstream 1402871 54726796 ~ 54727895 (-) True G1464954
TU1675706 other downstream 1413276 54716104 ~ 54717490 (-) True G1464950
TU1675686 other downstream 1456847 54672252 ~ 54673919 (-) True G1464933
TU1675279 other downstream 1667064 54462671 ~ 54463702 (-) True G1464551
TU1677371 other upstream 17672 56162860 ~ 56167337 (-) True dnai1.2
TU1678487 other upstream 349668 56494856 ~ 56500200 (-) False elmo2
TU1678489 other upstream 349668 56494856 ~ 56500325 (-) False elmo2
TU1678490 other upstream 349668 56494856 ~ 56500135 (-) True elmo2
TU1678904 other upstream 1084319 57229507 ~ 57232707 (-) False hig1a

Expression Profile


TU1677370 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU1677370 Expression in each Bioproject

Bar chart with 16 bars.
TU1677370 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.