RNA id: TCONS_00046414


Basic Information

Item Value
RNA id TCONS_00046414
length 717
RNA type processed_transcript
GC content 0.48
exon number 5
gene id XLOC_023462
representative False

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 24101811 ~ 24163201 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TACTGCTGTCTGCTCGGAGACCGTGATGAGGGTCGAATGAAACAAACCTGAGGTCAAACTGCTCGTTTTTCTGTCGATCTTTTGATTTATCAACTTAAATAGTGATCGATAGTTAAACGTATTGGGTCGGAATGCTGTCTGGATATTGAGCATTGGAATACACCCAGAGAAAAACTGCAAATGGCCACCGTCGTGGAAAACCTGATAGATGGAGGGTCAAAAAAGGACAGAATTCGACAGGCCAAAGAAAGAAGAGAGGAGAAAGATAAGAGCCAAGGTGAAGAGCAGAGAGGAAGAAGGTCAGTGCTTCATTCTGTGGACCACTGGACGACTCCAGAGGAGCGGCCACCACCCCGAAAACCCCTCAGACTGAGAAGCCGGAAAAAAGCATCGCCCAAACTTTAGCTGACTCGACGATGAAGAAACTGGAGTCTCCAACAACGCCCACTCGAAGCTCCTCCTCCACTCGCAAAAACCCCAGCACACCGAAAAGATCTAAGTCTTGTAAGAGTCGTATTCAGTCTCCAGCCTCTCCGGGTCAGTTTCCTTCATCCCCAATGAGACACAGAGCAACAACACCCAGTGCTGAGAACAGAATTCGGGACGGGGAAGAGAAAATTTCGGAGGGGAGTAAAGGATACAGCACTCTAGAGAGAAAGAGCTCCAGAACTGAGAGAATGCCCAAATCCACAAGCAAAGAGTTTGGACACAACGCAG

Function

GO:

id name namespace
GO:0045944 positive regulation of transcription by RNA polymerase II biological_process
GO:0016592 mediator complex cellular_component
GO:0003677 DNA binding molecular_function
GO:0003712 transcription coregulator activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-091118-82 Predicted to be involved in microtubule cytoskeleton organization. Predicted to be active in microtubule cytoskeleton. Orthologous to human MAP7D2 (MAP7 domain containing 2).

Ensembl:

ensembl_id ENSDART00000143625

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00046410 lncRNA downstream 21018 24111222 ~ 24114884 (-) False XLOC_023462
TCONS_00047193 lncRNA downstream 37023 24095316 ~ 24098879 (-) True XLOC_023461
TCONS_00047192 lncRNA downstream 37028 24095316 ~ 24098874 (-) False XLOC_023461
TCONS_00046860 lncRNA downstream 378605 23755234 ~ 23757297 (-) True XLOC_023454
TCONS_00046859 lncRNA downstream 383327 23748335 ~ 23752575 (-) False XLOC_023454
TCONS_00046418 lncRNA upstream 3860 24166970 ~ 24168462 (-) True XLOC_023463
TCONS_00046423 lncRNA upstream 253214 24416324 ~ 24451847 (-) False XLOC_023466
TCONS_00047194 lncRNA upstream 253214 24416324 ~ 24456346 (-) False XLOC_023466
TCONS_00046424 lncRNA upstream 253214 24416324 ~ 24503022 (-) False XLOC_023466
TCONS_00046861 lncRNA upstream 256185 24419295 ~ 24451803 (-) False XLOC_023466
TCONS_00046407 mRNA downstream 17451 24101811 ~ 24118451 (-) False XLOC_023462
TCONS_00046408 mRNA downstream 21685 24101814 ~ 24114217 (-) False XLOC_023462
TCONS_00046406 mRNA downstream 24228 24101811 ~ 24111674 (-) False XLOC_023462
TCONS_00046404 mRNA downstream 75270 24036195 ~ 24060632 (-) False XLOC_023460
TCONS_00046405 mRNA downstream 75442 24052745 ~ 24060460 (-) True XLOC_023460
TCONS_00046416 mRNA upstream 1117 24164227 ~ 24168533 (-) False XLOC_023463
TCONS_00046417 mRNA upstream 1878 24164988 ~ 24168475 (-) False XLOC_023463
TCONS_00046419 mRNA upstream 20642 24183752 ~ 24271629 (-) True XLOC_023464
TCONS_00046420 mRNA upstream 110261 24273371 ~ 24282427 (-) False XLOC_023465
TCONS_00046421 mRNA upstream 110339 24273449 ~ 24281806 (-) False XLOC_023465
TCONS_00046409 other downstream 17507 24102721 ~ 24118395 (-) False XLOC_023462
TCONS_00046400 other downstream 158617 23971056 ~ 23977285 (-) False XLOC_023458
TCONS_00046386 other downstream 862543 23273242 ~ 23273359 (-) True XLOC_023450
TCONS_00046372 other downstream 1763802 22371986 ~ 22372100 (-) True XLOC_023446
TCONS_00046371 other downstream 1826844 22308944 ~ 22309058 (-) True XLOC_023445
TCONS_00046441 other upstream 845207 25008317 ~ 25024023 (-) False XLOC_023476
TCONS_00046479 other upstream 2196129 26359239 ~ 26362471 (-) False XLOC_023496
TCONS_00046480 other upstream 2198636 26361746 ~ 26368871 (-) True XLOC_023496
TCONS_00046487 other upstream 2312072 26475182 ~ 26479841 (-) False XLOC_023500
TCONS_00046496 other upstream 2345778 26508888 ~ 26534654 (-) False XLOC_023502

Expression Profile

//