RNA id: TCONS_00046513


Basic Information

Item Value
RNA id TCONS_00046513
length 383
lncRNA type retained_intron
GC content 0.44
exon number 3
gene id XLOC_023509
representative True

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 27396989 ~ 27400630 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCATTTCAGATACCAGAAGTGAAACTGTGACAATGAAAACACAAAAGATCTTCATGAGGAGTTTGGCTGTTGCACTTACTGCATCAGTGATCTGGACTGTTACAGCAGTCGCTGATAATGTGGAATCATGCTGTACCCCAGTCTCCACACCAGAGCTCACCGATCCCATCATGAGTGTGAGGATCCAGTTTGAAAGTCTTGAGTGTGAGACGGCCATCGTCTTCAAGACTGAAGAGCGGGAGTTGTGCTCTGATCCTAGACAACTGTGGGTGAGGAGGAAGGTCATGCAGTTCTAGTAAGTGAAAGCAAACACGTTTGATAAAACTACATTTTTCAGAACATAAACTGCTTATAAAGTGTTCAAACATCAGGTGTCCTGCACA

Function

GO:

id name namespace
GO:0043547 positive regulation of GTPase activity biological_process
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0002548 monocyte chemotaxis biological_process
GO:0006954 inflammatory response biological_process
GO:0006955 immune response biological_process
GO:0071346 cellular response to interferon-gamma biological_process
GO:0071347 cellular response to interleukin-1 biological_process
GO:0071356 cellular response to tumor necrosis factor biological_process
GO:0048247 lymphocyte chemotaxis biological_process
GO:0070098 chemokine-mediated signaling pathway biological_process
GO:0070374 positive regulation of ERK1 and ERK2 cascade biological_process
GO:0030593 neutrophil chemotaxis biological_process
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0048020 CCR chemokine receptor binding molecular_function
GO:0008009 chemokine activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-091204-276 Predicted to enable CCR chemokine receptor binding activity and chemokine activity. Predicted to be involved in several processes, including cellular response to cytokine stimulus; leukocyte chemotaxis; and positive regulation of ERK1 and ERK2 cascade. Predicted to act upstream of or within immune response. Predicted to be located in extracellular region. Predicted to be active in extracellular space.

Ensembl:

ensembl_id ENSDART00000137420

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00046510 lncRNA downstream 143115 27246507 ~ 27256345 (-) True XLOC_023508
TCONS_00046509 lncRNA downstream 143122 27244609 ~ 27256338 (-) False XLOC_023508
TCONS_00046508 lncRNA downstream 155032 27238781 ~ 27244428 (-) False XLOC_023508
TCONS_00047210 lncRNA downstream 447416 26948712 ~ 26952044 (-) False XLOC_023507
TCONS_00047209 lncRNA downstream 751437 26641899 ~ 26648023 (-) True XLOC_023503
TCONS_00047211 lncRNA upstream 62930 27462936 ~ 27463524 (-) True XLOC_023517
TCONS_00046869 lncRNA upstream 63555 27463561 ~ 27464451 (-) False XLOC_023518
TCONS_00046870 lncRNA upstream 63598 27463604 ~ 27464451 (-) True XLOC_023518
TCONS_00047212 lncRNA upstream 89809 27489815 ~ 27491197 (-) True XLOC_023520
TCONS_00047213 lncRNA upstream 356870 27756876 ~ 27776814 (-) True XLOC_023521
TCONS_00046506 mRNA downstream 142787 27223952 ~ 27256673 (-) False XLOC_023508
TCONS_00046507 mRNA downstream 143122 27224743 ~ 27256338 (-) False XLOC_023508
TCONS_00046504 mRNA downstream 404296 26948712 ~ 26995164 (-) False XLOC_023507
TCONS_00046505 mRNA downstream 417612 26949664 ~ 26981848 (-) True XLOC_023507
TCONS_00046503 mRNA downstream 454070 26941197 ~ 26945390 (-) True XLOC_023506
TCONS_00046514 mRNA upstream 7949 27407955 ~ 27409599 (-) True XLOC_023510
TCONS_00046515 mRNA upstream 16586 27416592 ~ 27419198 (-) True XLOC_023511
TCONS_00046516 mRNA upstream 21070 27421076 ~ 27423697 (-) False XLOC_023512
TCONS_00046517 mRNA upstream 21484 27421490 ~ 27422270 (-) True XLOC_023512
TCONS_00046518 mRNA upstream 28135 27428141 ~ 27430612 (-) True XLOC_023513
TCONS_00046496 other downstream 864806 26508888 ~ 26534654 (-) False XLOC_023502
TCONS_00046487 other downstream 919619 26475182 ~ 26479841 (-) False XLOC_023500
TCONS_00046480 other downstream 1030589 26361746 ~ 26368871 (-) True XLOC_023496
TCONS_00046479 other downstream 1036989 26359239 ~ 26362471 (-) False XLOC_023496
TCONS_00046441 other downstream 2375437 25008317 ~ 25024023 (-) False XLOC_023476
TCONS_00046542 other upstream 1627422 29027428 ~ 29028548 (-) False XLOC_023535
TCONS_00046544 other upstream 1627442 29027448 ~ 29030632 (-) False XLOC_023535
TCONS_00046545 other upstream 1628396 29028402 ~ 29029657 (-) False XLOC_023535
TCONS_00046546 other upstream 1628401 29028407 ~ 29030633 (-) False XLOC_023535
TCONS_00046551 other upstream 1634618 29034624 ~ 29034740 (-) True XLOC_023536

Expression Profile

//