RNA id: TCONS_00046577


Basic Information

Item Value
RNA id TCONS_00046577
length 659
RNA type nonsense_mediated_decay
GC content 0.53
exon number 5
gene id XLOC_023555
representative True

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 31081504 ~ 31092711 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGCTGGTGTTCATCATGGGCGCATCCGTATCCAGTCTTGCTCCCACTATTCGGGCAGAGTCTGTGATTTCCGCTCCTCATTTTGCCGGTGCTTCTCCTCCCCCCGGGTGTCCCATGCATCAGGAGCCTCCCAAAATAGCAATAATTGATCATGTGTAATGTAAACCCAGGCTCTCCGCCTCCTGAGTGCCCGATGCATCAGGCTCAGACACCACCGGCTGCTCCTGTGCATCAGGAAAGAGCTTACGAGTTTGTCGAATGTCCCATGAGGGCCAAAGAAGGAGCCATTGATCCGACAAATATGATGCCTCCTCCAAACCAAGTGCCCGCTCCAGACCAGCCATTCCCACTGTCTGTGAAACGAGAGGAGTCTAAAATCCCTCGATCAGGCACAGAGCAGAACTGGGTCTATCCTTCTGAACAGATGTTCTGGAACGCCATGCTGAGGAAAGGGTGGCGTTGGAAGGATGACACCCTCGCTCCTGAAGACATGTCTAATATAATCCAGATCCACAACCGTAACAACGATCAAGCCTGGCAGGAAATCCTGAAGTGGGAAGCACTACATGCCAGCGAATGTCCTTGCGGTCCATCTCTGAAGAGATTCGGAGGAAAAGCCAAAGAGTTTTCTCCCAGAGCCAGAATACGTCACTGGATGGG

Function

GO:

id name namespace
GO:0018063 cytochrome c-heme linkage biological_process
GO:0005743 mitochondrial inner membrane cellular_component
GO:0016020 membrane cellular_component
GO:0005739 mitochondrion cellular_component
GO:0046872 metal ion binding molecular_function
GO:0016829 lyase activity molecular_function
GO:0004408 holocytochrome-c synthase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-000607-78 Predicted to enable holocytochrome-c synthase activity. Predicted to be involved in cytochrome c-heme linkage. Predicted to be located in mitochondrial inner membrane. Predicted to be active in mitochondrion. Is expressed in several structures, including adaxial cell; alar plate midbrain region; immature eye; musculature system; and retina. Human ortholog(s) of this gene implicated in linear skin defects with multiple congenital anomalies 1 and microphthalmia. Orthologous to human HCCS (holocytochrome c synthase).

Ensembl:

ensembl_id ENSDART00000169854

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00046574 lncRNA downstream 3256 31055418 ~ 31081433 (-) True XLOC_023554
TCONS_00046875 lncRNA downstream 8160 31040020 ~ 31076529 (-) False XLOC_023554
TCONS_00046874 lncRNA downstream 111826 30927688 ~ 30972863 (-) True XLOC_023553
TCONS_00046873 lncRNA downstream 172824 30903443 ~ 30911865 (-) True XLOC_023552
TCONS_00046573 lncRNA downstream 244370 30837447 ~ 30840319 (-) True XLOC_023551
TCONS_00046578 lncRNA upstream 7586 31098534 ~ 31100851 (-) False XLOC_023556
TCONS_00046876 lncRNA upstream 364138 31455086 ~ 31458194 (-) False XLOC_023563
TCONS_00047218 lncRNA upstream 366140 31457088 ~ 31457818 (-) False XLOC_023563
TCONS_00047219 lncRNA upstream 366140 31457088 ~ 31457834 (-) False XLOC_023563
TCONS_00047220 lncRNA upstream 366140 31457088 ~ 31457843 (-) True XLOC_023563
TCONS_00046571 mRNA downstream 222521 30835929 ~ 30862168 (-) False XLOC_023551
TCONS_00046572 mRNA downstream 241439 30836160 ~ 30843250 (-) False XLOC_023551
TCONS_00046568 mRNA downstream 808954 30227941 ~ 30275735 (-) False XLOC_023549
TCONS_00046567 mRNA downstream 809485 30225967 ~ 30275204 (-) False XLOC_023549
TCONS_00046569 mRNA downstream 821388 30228270 ~ 30263301 (-) True XLOC_023549
TCONS_00046579 mRNA upstream 7610 31098558 ~ 31140356 (-) False XLOC_023556
TCONS_00046580 mRNA upstream 25666 31116614 ~ 31123365 (-) True XLOC_023556
TCONS_00046581 mRNA upstream 79414 31170362 ~ 31194847 (-) True XLOC_023557
TCONS_00046582 mRNA upstream 110247 31201195 ~ 31223232 (-) False XLOC_023558
TCONS_00046584 mRNA upstream 203071 31294019 ~ 31306724 (-) True XLOC_023559
TCONS_00046564 other downstream 1087499 29964976 ~ 29997190 (-) True XLOC_023547
TCONS_00046553 other downstream 1610714 29473856 ~ 29473975 (-) True XLOC_023538
TCONS_00046552 other downstream 2031863 29052708 ~ 29052826 (-) True XLOC_023537
TCONS_00046551 other downstream 2049949 29034624 ~ 29034740 (-) True XLOC_023536
TCONS_00046546 other downstream 2054056 29028407 ~ 29030633 (-) False XLOC_023535
TCONS_00046583 other upstream 127875 31218823 ~ 31223183 (-) True XLOC_023558
TCONS_00046586 other upstream 232407 31323355 ~ 31331913 (-) True XLOC_023560
TCONS_00046592 other upstream 549364 31640312 ~ 31640427 (-) True XLOC_023564
TCONS_00046593 other upstream 695515 31786463 ~ 31786577 (-) True XLOC_023567
TCONS_00046605 other upstream 1082190 32173138 ~ 32196412 (-) True XLOC_023573

Expression Profile

//