RNA id: TCONS_00046586



Basic Information


Item Value
RNA id TCONS_00046586
length 460
RNA type processed_transcript
GC content 0.47
exon number 6
gene id XLOC_023560
representative True

Chromosome Information


Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 31310640 ~ 31332087 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GGCGGCCGTCAGCAAGTACTTGACAGCGAAGAACTCCGCGGTGGCTGGCGGTGTCCTACTCGTTTTATACATCCTAAAGCAGAGACGAAGAGCCGCAGCACTAAACAGGAAGAAGGGGTCTGCAAATGAATTGAACAGTGAGAAAGATGGCAAGAAAGAAAGGGCCGCTGTGGACAAGTTATTTTTCATCCGGATCTCACGGATCCTCAAGATTATGGTTCCGAAATTCTTCAGCAAAGAGACATGGTATCTGCTCCTGATCGCAGTGATGCTTGTGACTCGGACGTATTGTGATGTCTGGATGATTCAGAACGGCACAATGATTGAAAGATCGCCCTGGTGAATAACTTCCTGAAGTTGGGCCTGAATGAACTGAAATTGTGCTTTCGTGTGAGGCTTACCAAACATCTCTACGATGAATACCTAAAGGGATATACGTACTACAAAATGGGAAACCTGG

Function


GO:

id name namespace
GO:0006635 fatty acid beta-oxidation biological_process
GO:0042760 very long-chain fatty acid catabolic process biological_process
GO:0015910 long-chain fatty acid import into peroxisome biological_process
GO:0007031 peroxisome organization biological_process
GO:0055085 transmembrane transport biological_process
GO:0005777 peroxisome cellular_component
GO:0005778 peroxisomal membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005524 ATP binding molecular_function
GO:0042803 protein homodimerization activity molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0016887 ATPase activity molecular_function
GO:0042626 ATPase-coupled transmembrane transporter activity molecular_function
GO:0005324 long-chain fatty acid transporter activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2868 Predicted to enable ATP binding activity; ATPase-coupled transmembrane transporter activity; and long-chain fatty acid transporter activity. Predicted to be involved in fatty acid catabolic process; long-chain fatty acid import into peroxisome; and peroxisome organization. Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane and peroxisome. Predicted to be integral component of membrane. Predicted to be active in peroxisomal membrane. Human ortholog(s) of this gene implicated in Zellweger syndrome and congenital bile acid synthesis defect 5. Orthologous to human ABCD3 (ATP binding cassette subfamily D member 3).

Ensembl:

ensembl_id ENSDART00000169556

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00046578 lncRNA downstream 222504 31098534 ~ 31100851 (-) False XLOC_023556
TCONS_00046574 lncRNA downstream 241922 31055418 ~ 31081433 (-) True XLOC_023554
TCONS_00046875 lncRNA downstream 246826 31040020 ~ 31076529 (-) False XLOC_023554
TCONS_00046874 lncRNA downstream 350492 30927688 ~ 30972863 (-) True XLOC_023553
TCONS_00046873 lncRNA downstream 411490 30903443 ~ 30911865 (-) True XLOC_023552
TCONS_00046876 lncRNA upstream 123173 31455086 ~ 31458194 (-) False XLOC_023563
TCONS_00047218 lncRNA upstream 125175 31457088 ~ 31457818 (-) False XLOC_023563
TCONS_00047219 lncRNA upstream 125175 31457088 ~ 31457834 (-) False XLOC_023563
TCONS_00047220 lncRNA upstream 125175 31457088 ~ 31457843 (-) True XLOC_023563
TCONS_00047221 lncRNA upstream 377588 31709501 ~ 31717481 (-) True XLOC_023565
TCONS_00046584 mRNA downstream 16631 31294019 ~ 31306724 (-) True XLOC_023559
TCONS_00046582 mRNA downstream 100123 31201195 ~ 31223232 (-) False XLOC_023558
TCONS_00046581 mRNA downstream 128508 31170362 ~ 31194847 (-) True XLOC_023557
TCONS_00046579 mRNA downstream 182999 31098558 ~ 31140356 (-) False XLOC_023556
TCONS_00046580 mRNA downstream 199990 31116614 ~ 31123365 (-) True XLOC_023556
TCONS_00046587 mRNA upstream 70981 31402894 ~ 31422574 (-) False XLOC_023561
TCONS_00046588 mRNA upstream 74461 31406374 ~ 31425799 (-) True XLOC_023561
TCONS_00046589 mRNA upstream 98977 31430890 ~ 31452923 (-) False XLOC_023562
TCONS_00046590 mRNA upstream 99509 31431422 ~ 31439841 (-) False XLOC_023562
TCONS_00046591 mRNA upstream 99509 31431422 ~ 31452875 (-) True XLOC_023562
TCONS_00046583 other downstream 100172 31218823 ~ 31223183 (-) True XLOC_023558
TCONS_00046577 other downstream 232407 31084689 ~ 31090948 (-) True XLOC_023555
TCONS_00046564 other downstream 1326165 29964976 ~ 29997190 (-) True XLOC_023547
TCONS_00046553 other downstream 1849380 29473856 ~ 29473975 (-) True XLOC_023538
TCONS_00046552 other downstream 2270529 29052708 ~ 29052826 (-) True XLOC_023537
TCONS_00046592 other upstream 308399 31640312 ~ 31640427 (-) True XLOC_023564
TCONS_00046593 other upstream 454550 31786463 ~ 31786577 (-) True XLOC_023567
TCONS_00046605 other upstream 841225 32173138 ~ 32196412 (-) True XLOC_023573
TCONS_00046633 other upstream 2780843 34112756 ~ 34115514 (-) True XLOC_023597
TCONS_00046660 other upstream 4963398 36295311 ~ 36300996 (-) True XLOC_023621

Expression Profile


//