RNA id: TU1636888



Basic Information


Item Value
RNA id TU1636888
length 288
RNA type TUCP
GC content 0.54
exon number 1
gene id G1429643
representative True

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 23254893 ~ 23255180 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctggacaaaaggaacacctatgtaagaatgctattcattgaatgcagctcagcgttcaacaccatagtaccctcaaagctcatcaataagctaaggaccctgggactaaacacctccctctgcaactggatcctggacttcctgatgggccggccccaggtggtgagggtaggtggcaacacatctgccacgctgatcctcaacactggagctccccagggatgcgtgctcagttccctcctgtactccttgttcacccacgactgcatggccaggcacgacaccaac

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1636886 lncRNA downstream 772 23253809 ~ 23254121 (-) True G1429641
TU1636883 lncRNA downstream 6598 23248038 ~ 23248295 (-) True G1429638
TU1636842 lncRNA downstream 8705 23169746 ~ 23246188 (-) True G1429603
TU1636890 lncRNA upstream 2475 23257655 ~ 23257949 (-) True G1429645
TU1636891 lncRNA upstream 4121 23259301 ~ 23259522 (-) True G1429646
TU1636894 lncRNA upstream 8268 23263448 ~ 23309397 (-) True G1429649
TU1636920 lncRNA upstream 73923 23329103 ~ 23329338 (-) True G1429669
TU1636921 lncRNA upstream 74684 23329864 ~ 23330151 (-) True G1429670
XM_021567764.2 mRNA downstream 69136 23178814 ~ 23185757 (-) True LOC110493470
XM_021567769.2 mRNA downstream 121413 23125813 ~ 23133480 (-) True LOC110493473
XM_036949418.1 mRNA downstream 130909 23101801 ~ 23123984 (-) True LOC110493472
LOC110495109 mRNA upstream 102403 23357583 ~ 23364991 (-) True LOC110495109
XM_036949431.1 mRNA upstream 112067 23367247 ~ 23392263 (-) False LOC110495110
XM_036949432.1 mRNA upstream 112067 23367247 ~ 23392263 (-) False LOC110495110
XM_021567823.2 mRNA upstream 137276 23392456 ~ 23400169 (-) False LOC110493511
XM_036949430.1 mRNA upstream 137294 23392474 ~ 23397785 (-) False LOC110493511
TU1636887 other downstream 301 23254322 ~ 23254592 (-) True G1429642
TU1635889 other downstream 914330 22339379 ~ 22340563 (-) True G1428740
TU1635348 other downstream 1450233 21804331 ~ 21804660 (-) True G1428291
TU1635205 other downstream 1627613 21626677 ~ 21627280 (-) True G1428161
TU1634843 other downstream 1845695 21407082 ~ 21409198 (-) True LOC110493443
TU1636877 other upstream 97318 23352498 ~ 23353008 (-) True LOC110493468
TU1637017 other upstream 149471 23404651 ~ 23405012 (-) True LOC110495111
TU1637959 other upstream 800959 24056139 ~ 24057295 (-) True LOC110493531
TU1638034 other upstream 951224 24206404 ~ 24207771 (-) True G1430651
TU1638688 other upstream 1233315 24488495 ~ 24489228 (-) True G1431278

Expression Profile


TU1636888 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU1636888 Expression in each Bioproject

Bar chart with 18 bars.
TU1636888 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.