RNA id: TU1637865



Basic Information


Item Value
RNA id TU1637865
length 376
lncRNA type intronic
GC content 0.44
exon number 1
gene id G1430492
representative True

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 23886501 ~ 23886876 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


acaaatctccgtcccagtctcaggtcttttgcagactccatcaggttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggtccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagtgtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttccattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctccctaaacgacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1637864 lncRNA downstream 192 23885950 ~ 23886309 (-) True G1430491
TU1637863 lncRNA downstream 645 23885469 ~ 23885856 (-) True G1430490
TU1637861 lncRNA downstream 2037 23882633 ~ 23884464 (-) True LOC110493524
TU1637850 lncRNA downstream 18285 23867201 ~ 23868216 (-) False G1430486
TU1637854 lncRNA downstream 18383 23867201 ~ 23868118 (-) True G1430486
TU1637872 lncRNA upstream 16735 23903611 ~ 23903841 (-) True G1430499
TU1637889 lncRNA upstream 40720 23927596 ~ 23927843 (-) True G1430511
TU1637930 lncRNA upstream 132195 24019071 ~ 24019982 (-) True G1430551
TU1637932 lncRNA upstream 133261 24020137 ~ 24020372 (-) True G1430552
TU1637940 lncRNA upstream 148864 24035740 ~ 24040552 (-) True LOC110493530
XR_002469154.2 mRNA downstream 2027 23882571 ~ 23884474 (-) False LOC110493524
XR_005036884.1 mRNA downstream 5889 23872151 ~ 23880612 (-) False LOC110493520
XM_021567851.2 mRNA downstream 5889 23872717 ~ 23880612 (-) False LOC110493520
XM_036949445.1 mRNA downstream 5889 23872717 ~ 23880612 (-) True LOC110493520
XM_036949446.1 mRNA downstream 11719 23868339 ~ 23874782 (-) False LOC110493520
XM_036949453.1 mRNA upstream 20523 23907399 ~ 23943818 (-) False LOC110493527
XM_036949452.1 mRNA upstream 20523 23907399 ~ 23959564 (-) False LOC110493527
XM_036949454.1 mRNA upstream 23841 23910717 ~ 23959574 (-) True LOC110493527
XM_036949456.1 mRNA upstream 76316 23963192 ~ 24031795 (-) True LOC110493529
LOC110493530 mRNA upstream 147476 24034352 ~ 24051965 (-) False LOC110493530
TU1637017 other downstream 481489 23404651 ~ 23405012 (-) True LOC110495111
TU1636877 other downstream 533493 23352498 ~ 23353008 (-) True LOC110493468
TU1636888 other downstream 631321 23254893 ~ 23255180 (-) True G1429643
TU1636887 other downstream 631909 23254322 ~ 23254592 (-) True G1429642
TU1635889 other downstream 1545938 22339379 ~ 22340563 (-) True G1428740
TU1637959 other upstream 169263 24056139 ~ 24057295 (-) True LOC110493531
TU1638034 other upstream 319528 24206404 ~ 24207771 (-) True G1430651
TU1638688 other upstream 601619 24488495 ~ 24489228 (-) True G1431278
TU1640605 other upstream 1917895 25804771 ~ 25806202 (-) True cxcf1b
TU1640645 other upstream 2087506 25974382 ~ 25982561 (-) False G1433142

Expression Profile


TU1637865 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU1637865 Expression in each Bioproject

Bar chart with 18 bars.
TU1637865 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.