RNA id: TU1640565



Basic Information


Item Value
RNA id TU1640565
length 312
lncRNA type inter_gene
GC content 0.36
exon number 1
gene id G1433069
representative True

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 26599530 ~ 26599841 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TTATAAACACACTGGTTAAGTTAGCAGGCCTGCTTTATGTCTGTGTTCTATTATGATGGAGCTGCTTGTCAATCAAAAGGGCTATATATTGTAGATGCTTCAGAAATAATTCATTCAAGTAAATGTTATGCTATTTAAAGGGGTTGCGCTACTTTTGTCAACGGCCAGATAAAAGGACCTTCTACAGCTCCTTTAATGTAGTATGTGTCTGCTTATAAATAATTGGTGATCCATCTATGTAGTGCTTTTGAATACTTAATGAAAGCTCAATTAAGCCTTGATAATTGGTTTAAGTGCGCCTGAACTACCTCC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1640561 lncRNA upstream 6598 26592706 ~ 26592932 (+) True G1433065
TU1640545 lncRNA upstream 6930 26559869 ~ 26592600 (+) True G1433049
TU1640467 lncRNA upstream 11131 26586811 ~ 26588399 (+) True LOC110493556
TU1640414 lncRNA upstream 224756 26374455 ~ 26374774 (+) True G1432933
TU1640413 lncRNA upstream 225362 26373933 ~ 26374168 (+) True G1432932
TU1640566 lncRNA downstream 2033 26601874 ~ 26602200 (+) True G1433070
TU1641165 lncRNA downstream 42533 26642374 ~ 26642687 (+) True G1433548
TU1641234 lncRNA downstream 70834 26670675 ~ 26672270 (+) True G1433609
TU1641237 lncRNA downstream 72931 26672772 ~ 26672985 (+) True G1433611
TU1641285 lncRNA downstream 193882 26793723 ~ 26799993 (+) True LOC110493561
XR_002469161.2 mRNA upstream 11120 26463797 ~ 26588410 (+) False LOC110493556
XR_002469162.2 mRNA upstream 11120 26463797 ~ 26588410 (+) False LOC110493556
XR_002469163.2 mRNA upstream 11120 26463797 ~ 26588410 (+) False LOC110493556
XM_021567902.2 mRNA upstream 13554 26463797 ~ 26585976 (+) False LOC110493556
LOC110495117 mRNA upstream 138057 26447325 ~ 26461473 (+) True LOC110495117
XM_021567903.2 mRNA downstream 22279 26622120 ~ 26662866 (+) True LOC110493557
XM_021567904.2 mRNA downstream 75603 26675444 ~ 26683103 (+) True LOC110493558
XM_021567906.2 mRNA downstream 83211 26683052 ~ 26685644 (+) False LOC110493559
NM_001160507.1 mRNA downstream 87757 26687598 ~ 26699282 (+) True hn1
XM_036949491.1 mRNA downstream 158600 26758441 ~ 26783308 (+) False LOC110493561
TU1640082 other upstream 776267 25762966 ~ 25823263 (+) True G1432630
TU1637188 other upstream 2734132 23863025 ~ 23865398 (+) True LOC110493519
TU1637051 other upstream 3151800 23447060 ~ 23447730 (+) True G1429776
TU1637050 other upstream 3152553 23446548 ~ 23446977 (+) True G1429775
TU1636539 other upstream 3497778 23095531 ~ 23101752 (+) True LOC110493474
TU1641244 other downstream 83484 26683325 ~ 26685641 (+) False LOC110493559
TU1641243 other downstream 83534 26683375 ~ 26685641 (+) True LOC110493559
TU1641606 other downstream 720136 27319977 ~ 27333173 (+) False LOC110493575
TU1642233 other downstream 937354 27537195 ~ 27537570 (+) True LOC118940374
TU1642237 other downstream 943346 27543187 ~ 27543578 (+) False LOC110493581

Expression Profile


TU1640565 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

TU1640565 Expression in each Bioproject

Bar chart with 5 bars.
TU1640565 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.