RNA id: TU1716066



Basic Information


Item Value
RNA id TU1716066
length 346
lncRNA type intronic
GC content 0.44
exon number 2
gene id G1500918
representative True

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 86675632 ~ 86676110 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttagtaatgagactatatacaggggtacaggttagtaatgagactatatacagggggtacaggttagtaatgagactatatacagggggtacaggttagtaatgagactatatacagggggtacaggttagtaatgagactatatacagggagagccagtaccgagtcaatgtgcaggggtacaggttagtaatgagactatatacaggggtaccaagtcaatgtgcaggttagtaatgagactatatacagggggtaccaagtcaatgtgcaggggtacaggttagtaatgagactatatacagggggtaccggtaccgagtcaatgtgcaggggtacaggtta

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1716061 lncRNA downstream 2279 86671547 ~ 86673353 (-) True G1500913
TU1716035 lncRNA downstream 60276 86613680 ~ 86615356 (-) True G1500889
TU1716022 lncRNA downstream 95952 86575582 ~ 86579680 (-) False G1500879
TU1716023 lncRNA downstream 95952 86575582 ~ 86579680 (-) True G1500879
TU1716008 lncRNA downstream 131645 86543287 ~ 86543987 (-) True G1500866
TU1716081 lncRNA upstream 17766 86693876 ~ 86694307 (-) True G1500930
TU1716096 lncRNA upstream 27279 86703389 ~ 86781368 (-) True G1500941
TU1716059 lncRNA upstream 32585 86708695 ~ 86711199 (-) True G1500911
TU1716114 lncRNA upstream 56560 86732670 ~ 86733096 (-) True G1500958
TU1716098 lncRNA upstream 112418 86788528 ~ 86790791 (-) True G1500943
XM_021570138.2 mRNA downstream 65051 86605940 ~ 86610581 (-) True sp7
XM_036950865.1 mRNA downstream 119643 86540799 ~ 86555989 (-) True igsf8
XM_036950861.1 mRNA downstream 399573 86249232 ~ 86276059 (-) True dctn2
XM_036950859.1 mRNA downstream 399574 86249232 ~ 86276058 (-) False dctn2
XM_021570514.2 mRNA upstream 35343 86711453 ~ 86714926 (-) False LOC110495202
XM_021570515.2 mRNA upstream 35343 86711453 ~ 86714926 (-) True LOC110495202
XM_021570132.2 mRNA upstream 64438 86740548 ~ 86774465 (-) False LOC110494797
XM_036950872.1 mRNA upstream 64438 86740548 ~ 86774465 (-) True LOC110494797
XM_036950888.1 mRNA upstream 124843 86800953 ~ 86850473 (-) False LOC110493290
TU1715969 other downstream 224898 86449679 ~ 86450734 (-) True G1500834
TU1715872 other downstream 432704 86239718 ~ 86242928 (-) True LOC110494779
TU1714519 other downstream 1387515 85286656 ~ 85288117 (-) False G1499684
TU1714522 other downstream 1387515 85286656 ~ 85288117 (-) True G1499684
TU1714505 other downstream 1452513 85221125 ~ 85223119 (-) True G1499671
TU1716092 other upstream 121955 86798065 ~ 86806531 (-) False LOC110493290
TU1716093 other upstream 121955 86798065 ~ 86806531 (-) False LOC110493290
TU1716920 other upstream 457948 87134058 ~ 87159244 (-) False G1501650
TU1717031 other upstream 718670 87394780 ~ 87395835 (-) True G1501745
TU1717411 other upstream 1486168 88162278 ~ 88175346 (-) False dnsl3

Expression Profile


TU1716066 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU1716066 Expression in each Bioproject

Bar chart with 18 bars.
TU1716066 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.