RNA id: TU1717464



Basic Information


Item Value
RNA id TU1717464
length 218
lncRNA type inter_gene
GC content 0.51
exon number 1
gene id G1502110
representative True

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 88247393 ~ 88247610 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gaccacagcccggacttgaacccgattgaacatctctggagagaccagagaaaatacctgtgcagcgacgctcctcatccgacctgacaaagcttgagaggatctgcagagaagaatgggagaaactccccaaatacaggtgtgccaagcttgtagcgtcacacccaagaagacttgaggctgtaatcgctgctaaaggtgcttcaacaagtaaaggg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1717457 lncRNA downstream 15331 88229631 ~ 88232062 (-) True G1502103
TU1717443 lncRNA downstream 27443 88219031 ~ 88219950 (-) True G1502095
TU1717367 lncRNA downstream 63671 88181701 ~ 88183722 (-) True LOC110494815
TU1717405 lncRNA downstream 103985 88141454 ~ 88143408 (-) True G1502063
TU1717366 lncRNA downstream 163809 88083384 ~ 88083584 (-) True G1502025
TU1717465 lncRNA upstream 301 88247911 ~ 88248323 (-) True G1502111
TU1717468 lncRNA upstream 6232 88253842 ~ 88254100 (-) True G1502114
TU1717489 lncRNA upstream 36379 88283989 ~ 88296129 (-) False G1502135
TU1717490 lncRNA upstream 36379 88283989 ~ 88292237 (-) False G1502135
TU1717493 lncRNA upstream 36379 88283989 ~ 88289375 (-) False G1502135
XM_021570146.2 mRNA downstream 1888 88233684 ~ 88245505 (-) True zgc:171566
XM_021570147.2 mRNA downstream 63636 88181683 ~ 88183757 (-) False LOC110494815
NM_001165127.1 mRNA downstream 72048 88162116 ~ 88175345 (-) False dnsl3
XM_036950920.1 mRNA downstream 88389 88144616 ~ 88159004 (-) True LOC110493297
XM_036950913.1 mRNA downstream 739805 87494104 ~ 87507588 (-) True LOC110495200
XM_036948442.1 mRNA upstream 189636 88437246 ~ 88600371 (-) True LOC110494809
LOC110493292 mRNA upstream 625310 88872920 ~ 88877452 (-) False LOC110493292
XM_036950931.1 mRNA upstream 654248 88901858 ~ 88907612 (-) False LOC118940510
XM_036950929.1 mRNA upstream 654248 88901858 ~ 88907675 (-) True LOC118940510
XM_036950943.1 mRNA upstream 1329962 89577572 ~ 89658569 (-) False pcbp4
TU1717411 other downstream 72047 88162278 ~ 88175346 (-) False dnsl3
TU1717412 other downstream 82851 88162278 ~ 88164542 (-) True dnsl3
TU1717031 other downstream 851558 87394780 ~ 87395835 (-) True G1501745
TU1716920 other downstream 1088149 87134058 ~ 87159244 (-) False G1501650
TU1716092 other downstream 1440862 86798065 ~ 86806531 (-) False LOC110493290
TU1717937 other upstream 110542 88358152 ~ 88425505 (-) False G1502489
TU1717938 other upstream 171389 88418999 ~ 88425505 (-) False G1502489
TU1718044 other upstream 302756 88550366 ~ 88552831 (-) True G1502566
TU1718207 other upstream 625165 88872775 ~ 88874526 (-) True LOC110493292
TU1719190 other upstream 1328351 89575961 ~ 89578851 (-) True pcbp4

Expression Profile


TU1717464 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

TU1717464 Expression in each Bioproject

Bar chart with 19 bars.
TU1717464 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.