RNA id: TCONS_00047645


Basic Information

Item Value
RNA id TCONS_00047645
length 264
RNA type nonsense_mediated_decay
GC content 0.51
exon number 3
gene id XLOC_024003
representative False

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 17244532 ~ 17310301 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGTCCGAAGATGGCGACGGCCCAGCTGTACTGCGTCTGCCGGCAGCCGTACGACGTGAGCCGGTTTATGATAGAATGCGACATTTGTAAGGACTGGTTTCACGGCAGATTACTCAGATACGAGTAGGAGTCCACCTTTCTCCCAGATTTGAGGAGAAAGCCGCTTACTGTGTCATCCTGCAGTGGGTCAGGAACTGAGGAAGTGTGATGTAATGATTTTCCTGTGTCGAGGTTGAAGAGCACTATGCTGTGGACATTGACGTCT

Function

GO:

id name namespace
GO:0006325 chromatin organization biological_process
GO:0071557 histone H3-K27 demethylation biological_process
GO:0033169 histone H3-K9 demethylation biological_process
GO:0055114 oxidation-reduction process biological_process
GO:0007399 nervous system development biological_process
GO:0030901 midbrain development biological_process
GO:0005634 nucleus cellular_component
GO:0071558 histone demethylase activity (H3-K27 specific) molecular_function
GO:0046872 metal ion binding molecular_function
GO:0035575 histone demethylase activity (H4-K20 specific) molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0051213 dioxygenase activity molecular_function
GO:0032454 histone demethylase activity (H3-K9 specific) molecular_function
GO:0051864 histone demethylase activity (H3-K36 specific) molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050309-32 Enables histone demethylase activity (H3-K27 specific) and histone demethylase activity (H3-K9 specific). Involved in midbrain development. Acts upstream of or within histone H3-K27 demethylation and histone H3-K9 demethylation. Predicted to be located in nucleus. Is expressed in brain; fin; gill; and tail bud. Human ortholog(s) of this gene implicated in melanoma. Orthologous to human KDM7A (lysine demethylase 7A).

Ensembl:

ensembl_id ENSDART00000155510

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00049037 lncRNA upstream 284072 16958172 ~ 16960501 (+) True XLOC_024002
TCONS_00049214 lncRNA upstream 407624 16829884 ~ 16836949 (+) True XLOC_023998
TCONS_00047632 lncRNA upstream 728011 16516154 ~ 16516562 (+) True XLOC_023992
TCONS_00047631 lncRNA upstream 832141 16356226 ~ 16412432 (+) True XLOC_023991
TCONS_00049036 lncRNA upstream 1053842 16187651 ~ 16190731 (+) False XLOC_023988
TCONS_00047647 lncRNA downstream 25142 17295708 ~ 17304386 (+) True XLOC_024003
TCONS_00047650 lncRNA downstream 72254 17342820 ~ 17344073 (+) False XLOC_024004
TCONS_00047651 lncRNA downstream 74857 17345423 ~ 17346425 (+) True XLOC_024004
TCONS_00049038 lncRNA downstream 139551 17410117 ~ 17416453 (+) True XLOC_024005
TCONS_00049215 lncRNA downstream 232430 17502996 ~ 17510419 (+) True XLOC_024007
TCONS_00047643 mRNA upstream 292683 16945348 ~ 16951890 (+) True XLOC_024001
TCONS_00047639 mRNA upstream 302954 16880990 ~ 16941619 (+) False XLOC_024000
TCONS_00047642 mRNA upstream 305087 16915974 ~ 16939486 (+) True XLOC_024000
TCONS_00047640 mRNA upstream 305484 16895294 ~ 16939089 (+) False XLOC_024000
TCONS_00047641 mRNA upstream 305484 16912243 ~ 16939089 (+) False XLOC_024000
TCONS_00047648 mRNA downstream 43002 17313568 ~ 17346929 (+) False XLOC_024004
TCONS_00047649 mRNA downstream 69248 17339814 ~ 17341208 (+) False XLOC_024004
TCONS_00047652 mRNA downstream 134635 17405201 ~ 17419097 (+) False XLOC_024005
TCONS_00047653 mRNA downstream 152949 17423515 ~ 17471260 (+) True XLOC_024006
TCONS_00047654 mRNA downstream 319340 17589906 ~ 17613025 (+) False XLOC_024009
TCONS_00047637 other upstream 472665 16771791 ~ 16771908 (+) True XLOC_023997
TCONS_00047619 other upstream 1055735 16186344 ~ 16188838 (+) False XLOC_023988
TCONS_00047600 other upstream 1753906 15490212 ~ 15490667 (+) True XLOC_023979
TCONS_00047599 other upstream 1754929 15487494 ~ 15489644 (+) True XLOC_023978
TCONS_00047595 other upstream 2026464 15217824 ~ 15218109 (+) True XLOC_023973
TCONS_00047656 other downstream 334913 17605479 ~ 17608731 (+) True XLOC_024009
TCONS_00047663 other downstream 591802 17862368 ~ 17878632 (+) False XLOC_024013
TCONS_00047672 other downstream 827181 18097747 ~ 18097861 (+) True XLOC_024017
TCONS_00047675 other downstream 1212340 18482906 ~ 18489006 (+) True XLOC_024022
TCONS_00047695 other downstream 1824736 19095302 ~ 19111808 (+) False XLOC_024035

Expression Profile

//