RNA id: TCONS_00047735


Basic Information

Item Value
RNA id TCONS_00047735
length 539
RNA type mRNA
GC content 0.49
exon number 6
gene id XLOC_024054
representative True

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 19870603 ~ 19936598 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGGATTTACGCCGGCATCAAATTCTTTATCATTGACTTCATGTTCAAGAGCTGCCCAAAACTGAGGGACAAATACGACACTCCGTACATCGTGTGGACCACTTTACCCACAGATCCACAACTGAAAGAGCGCAACAACACCACGCTCAGCAGACGACTCTCTGGCTTTGAAAAGCTGGATCAAAATCGTCGCATTAGTTTGCACAAAAAGTATACTCACAAAAGTGAGGTTTTCGATCCGTCGTCAGCAGACAAGCAGATGCAGCCGGTGGTGGCGCGCAGCGGTCAGTCCACCAGCATGTCATGTGGAATCGGTCGAGAAGAGGAAAGCGGACGGGCTTACAACACCAAAAGAGGCCCTTTTCATGAAGTCTTTAACCTGTCTGAGAACGAGCGCCCTCTTTCAGTGTGTGAAAATGGCTGGCGATGCTGCTTGATCAACAGAGACAGAAAAATGCCGACTGATTACATCCGCAACGGTGTCCTCTACGTCACGGAAAATTACCTGTGTTTTGAAAGCTCCAGCTCTCGCGCAACATC

Function

GO:

id name namespace
GO:0034164 negative regulation of toll-like receptor 9 signaling pathway biological_process
GO:0043280 positive regulation of cysteine-type endopeptidase activity involved in apoptotic process biological_process
GO:0006915 apoptotic process biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-4780 Predicted to be involved in negative regulation of toll-like receptor 9 signaling pathway and positive regulation of cysteine-type endopeptidase activity involved in apoptotic process. Predicted to act upstream of or within apoptotic process. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human GRAMD4 (GRAM domain containing 4).

Ensembl:

ensembl_id ENSDART00000155029

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00047734 lncRNA upstream 30081 19870872 ~ 19883530 (+) False XLOC_024054
TCONS_00047728 lncRNA upstream 173646 19734160 ~ 19739965 (+) False XLOC_024051
TCONS_00047713 lncRNA upstream 357335 19552326 ~ 19556276 (+) True XLOC_024044
TCONS_00049225 lncRNA upstream 468099 19443951 ~ 19445512 (+) True XLOC_024041
TCONS_00049224 lncRNA upstream 551524 19356344 ~ 19362087 (+) True XLOC_024040
TCONS_00049226 lncRNA downstream 63056 19987068 ~ 19987387 (+) False XLOC_024057
TCONS_00049039 lncRNA downstream 63067 19987079 ~ 19997540 (+) False XLOC_024057
TCONS_00049040 lncRNA downstream 63067 19987079 ~ 19998226 (+) True XLOC_024057
TCONS_00049229 lncRNA downstream 179253 20103265 ~ 20109429 (+) False XLOC_024061
TCONS_00049228 lncRNA downstream 179253 20103265 ~ 20109429 (+) False XLOC_024061
TCONS_00047730 mRNA upstream 44116 19753890 ~ 19869495 (+) False XLOC_024052
TCONS_00047731 mRNA upstream 48502 19753935 ~ 19865109 (+) True XLOC_024052
TCONS_00047729 mRNA upstream 161466 19739665 ~ 19752145 (+) True XLOC_024051
TCONS_00047727 mRNA upstream 173645 19734038 ~ 19739966 (+) False XLOC_024051
TCONS_00047726 mRNA upstream 174107 19733751 ~ 19739504 (+) False XLOC_024051
TCONS_00047736 mRNA downstream 23084 19947096 ~ 19951331 (+) False XLOC_024055
TCONS_00047737 mRNA downstream 23286 19947298 ~ 19948767 (+) True XLOC_024055
TCONS_00047738 mRNA downstream 30564 19954576 ~ 19958278 (+) False XLOC_024056
TCONS_00047739 mRNA downstream 31586 19955598 ~ 19957076 (+) True XLOC_024056
TCONS_00047740 mRNA downstream 75611 19999623 ~ 20003528 (+) True XLOC_024058
TCONS_00047732 other upstream 138936 19774559 ~ 19774675 (+) True XLOC_024053
TCONS_00047707 other upstream 420991 19489550 ~ 19492620 (+) True XLOC_024042
TCONS_00047695 other upstream 801803 19095302 ~ 19111808 (+) False XLOC_024035
TCONS_00047675 other upstream 1424605 18482906 ~ 18489006 (+) True XLOC_024022
TCONS_00047672 other upstream 1815750 18097747 ~ 18097861 (+) True XLOC_024017
TCONS_00047755 other downstream 668471 20592483 ~ 20592597 (+) True XLOC_024066
TCONS_00047756 other downstream 679884 20603896 ~ 20604012 (+) True XLOC_024067
TCONS_00047785 other downstream 2301790 22225802 ~ 22238992 (+) True XLOC_024087
TCONS_00047798 other downstream 2663284 22587296 ~ 22594781 (+) False XLOC_024094
TCONS_00047805 other downstream 2806395 22730407 ~ 22849186 (+) False XLOC_024096

Expression Profile

//