RNA id: TU1746870



Basic Information


Item Value
RNA id TU1746870
length 235
lncRNA type inter_gene
GC content 0.58
exon number 1
gene id G1525651
representative True

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 21034026 ~ 21034260 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ggacagctcgggacagaggtaactcgggacagatgggtagctcagccctgagaggaagctcagcactgagaagaagctcagcactgagaagaagctcaggcaggtggttagatccggcagatcctggctggctggcggttctggaagatcctggctgactggcggatctgggagaatctggacgactggcagatctgggagaatctggacgactggcagatctgagagagtctgg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1746869 lncRNA downstream 2615 21031208 ~ 21031411 (-) True G1525650
TU1746868 lncRNA downstream 3219 21030033 ~ 21030807 (-) True G1525649
TU1746865 lncRNA downstream 8830 21024817 ~ 21025196 (-) True G1525646
TU1746864 lncRNA downstream 9333 21024346 ~ 21024693 (-) True G1525645
TU1746796 lncRNA downstream 141679 20892069 ~ 20892347 (-) True G1525597
TU1746872 lncRNA upstream 5429 21039689 ~ 21040025 (-) True G1525653
TU1746873 lncRNA upstream 6191 21040451 ~ 21040763 (-) True G1525654
TU1746874 lncRNA upstream 6516 21040776 ~ 21041183 (-) True G1525655
TU1746876 lncRNA upstream 8795 21043055 ~ 21043283 (-) True G1525657
TU1746757 lncRNA upstream 36654 21070914 ~ 21073322 (-) True LOC100136027
XM_021571264.2 mRNA downstream 5735 21018546 ~ 21028291 (-) True LOC110495812
XM_021571261.2 mRNA downstream 5736 21018546 ~ 21028290 (-) False LOC110495812
XM_021571259.2 mRNA downstream 5743 21018546 ~ 21028283 (-) False LOC110495812
XM_036952266.1 mRNA downstream 10856 21018546 ~ 21023170 (-) False LOC110495812
XM_021571260.2 mRNA downstream 10872 21018546 ~ 21023154 (-) False LOC110495812
NM_001124350.1 mRNA upstream 36622 21070882 ~ 21073264 (-) False LOC100136027
XM_021571265.2 mRNA upstream 40925 21075185 ~ 21088022 (-) True LOC110495813
XM_036952267.1 mRNA upstream 55093 21089353 ~ 21107524 (-) False LOC110495814
XM_021571267.2 mRNA upstream 130318 21164578 ~ 21173972 (-) False LOC110495815
XM_021571268.2 mRNA upstream 130318 21164578 ~ 21173972 (-) True LOC110495815
TU1746271 other downstream 462159 20571096 ~ 20571867 (-) True LOC110497093
TU1745849 other downstream 1303958 19722745 ~ 19730068 (-) False G1524755
TU1745850 other downstream 1308495 19723434 ~ 19725531 (-) True G1524755
TU1745684 other downstream 1456926 19573628 ~ 19577100 (-) True LOC110495764
TU1745534 other downstream 1869900 19143985 ~ 19164126 (-) True G1524473
TU1748552 other upstream 1227796 22262056 ~ 22262462 (-) True G1527230
TU1749447 other upstream 1837785 22872045 ~ 22885833 (-) True G1528018
TU1750411 other upstream 2125298 23159558 ~ 23168591 (-) True LOC110495841
TU1750687 other upstream 2447280 23481540 ~ 23541256 (-) True LOC110495851
TU1750685 other upstream 2508346 23542606 ~ 23543493 (-) True LOC110495852

Expression Profile


TU1746870 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU1746870 Expression in each Bioproject

Bar chart with 18 bars.
TU1746870 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.