RNA id: TU1766999



Basic Information


Item Value
RNA id TU1766999
length 261
RNA type TUCP
GC content 0.49
exon number 1
gene id G1544137
representative True

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 36862923 ~ 36863183 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gtatgagtgctgccagcattgctgcagaggttgaaggggtggggggtcagcctgtcagtgctcagaccatatgccgtacactgcatcaaattggtctgcatggctgtcgtcccagaaggaagcctcttctaaagatgatgcacaagaaagcccgcaaacagtttgctgaagacaagcagactaaggacatggattactggaaccatgtcctgtggtctgatgagaccaagataaacttatttggttcagatggtgtcaagc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1766997 lncRNA upstream 1379 36861339 ~ 36861544 (+) True G1544135
TU1766991 lncRNA upstream 13222 36849463 ~ 36849701 (+) True G1544129
TU1766985 lncRNA upstream 20224 36842459 ~ 36842699 (+) True G1544123
TU1766980 lncRNA upstream 26010 36836651 ~ 36836913 (+) True G1544118
TU1766964 lncRNA upstream 45364 36817349 ~ 36817559 (+) True G1544102
TU1767001 lncRNA downstream 4716 36867899 ~ 36868116 (+) True G1544139
TU1767004 lncRNA downstream 11296 36874479 ~ 36874691 (+) True G1544142
TU1766949 lncRNA downstream 68128 36931311 ~ 36932244 (+) True ext1c
TU1767252 lncRNA downstream 81573 36944756 ~ 36945009 (+) True G1544370
TU1767259 lncRNA downstream 86449 36949632 ~ 36949845 (+) True G1544377
XM_021571813.2 mRNA upstream 669073 36164916 ~ 36193850 (+) False med30
XM_021571814.2 mRNA upstream 669073 36164973 ~ 36193850 (+) False med30
XM_036952638.1 mRNA upstream 704532 36147703 ~ 36158391 (+) False LOC110496805
XM_036952639.1 mRNA upstream 704532 36148476 ~ 36158391 (+) True LOC110496805
XR_005037454.1 mRNA upstream 778157 36082109 ~ 36084766 (+) False LOC110496111
trnaa-ugc-136 mRNA downstream 73275 36936458 ~ 36936527 (+) True trnaa-ugc-136
XR_002469518.2 mRNA downstream 103196 36966379 ~ 36967979 (+) False LOC110496123
XR_002469520.2 mRNA downstream 152577 37015760 ~ 37018672 (+) False LOC110496127
LOC110496809 mRNA downstream 269406 37132589 ~ 37141720 (+) True LOC110496809
XM_036952654.1 mRNA downstream 602608 37465791 ~ 37720841 (+) True LOC110496810
TU1766867 other upstream 97690 36764294 ~ 36765233 (+) True G1544007
TU1765133 other upstream 771317 36086776 ~ 36091606 (+) True LOC110496111
TU1765134 other upstream 774566 36076661 ~ 36088357 (+) False LOC110496111
TU1765069 other upstream 899218 35961201 ~ 35963705 (+) True G1542324
TU1765023 other upstream 992365 35870237 ~ 35870558 (+) True G1542282
TU1767350 other downstream 192800 37055983 ~ 37056487 (+) True G1544455
TU1768221 other downstream 1330069 38193252 ~ 38204455 (+) False LOC110496158
TU1768223 other downstream 1330069 38193252 ~ 38204455 (+) True LOC110496158
TU1768508 other downstream 1811844 38675027 ~ 38676004 (+) True G1545533
TU1768490 other downstream 1827255 38690438 ~ 38691269 (+) False LOC110496176

Expression Profile


TU1766999 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU1766999 Expression in each Bioproject

Bar chart with 20 bars.
TU1766999 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.