RNA id: TU1774211



Basic Information


Item Value
RNA id TU1774211
length 208
lncRNA type inter_gene
GC content 0.41
exon number 1
gene id G1550594
representative True

Chromosome Information


Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 42781059 ~ 42781266 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gccagtttgcactgttctgtgaaggcagtagtacacagcgttgtatgagatcctcagtttcttggcaatttctcacatggaatagccttcatttctcagaacaagaatagactgatgagtttcagaagaaaggtctttgtttctggccattttgagcctgtaatcgaacccacaaatgctgatgctccagatattcaactagtctaaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1774210 lncRNA upstream 248 42780579 ~ 42780811 (+) True G1550593
TU1774085 lncRNA upstream 33704 42701324 ~ 42747355 (+) True LOC110496314
TU1774012 lncRNA upstream 155640 42625042 ~ 42625419 (+) True G1550411
TU1773996 lncRNA upstream 175742 42605019 ~ 42605317 (+) True G1550397
TU1773938 lncRNA upstream 208390 42563995 ~ 42572669 (+) True G1550342
TU1774251 lncRNA downstream 35620 42816886 ~ 42817129 (+) True G1550619
TU1774311 lncRNA downstream 91306 42872572 ~ 42954734 (+) False LOC110496322
TU1774278 lncRNA downstream 113765 42895031 ~ 42992078 (+) False LOC110496322
TU1774295 lncRNA downstream 113765 42895031 ~ 42976541 (+) False LOC110496322
TU1774297 lncRNA downstream 113765 42895031 ~ 42992078 (+) False LOC110496322
XM_036952889.1 mRNA upstream 33714 42711280 ~ 42747345 (+) False LOC110496314
XM_021572136.2 mRNA upstream 96046 42637639 ~ 42685013 (+) False LOC110496312
XM_036952893.1 mRNA downstream 43455 42824721 ~ 42850032 (+) False LOC110496316
XM_036952890.1 mRNA downstream 43456 42824722 ~ 42850032 (+) False LOC110496316
XM_036952891.1 mRNA downstream 43456 42824722 ~ 42850032 (+) False LOC110496316
XM_036952894.1 mRNA downstream 43456 42824722 ~ 42850032 (+) False LOC110496316
XM_036952895.1 mRNA downstream 43456 42824722 ~ 42850032 (+) False LOC110496316
TU1773187 other upstream 435305 42344986 ~ 42345754 (+) True G1549676
TU1772989 other upstream 740147 42037276 ~ 42040912 (+) True G1549511
TU1772902 other upstream 776563 42002819 ~ 42004496 (+) False LOC110496935
TU1772903 other upstream 776699 42002819 ~ 42004360 (+) True LOC110496935
TU1772905 other upstream 864984 41903543 ~ 41916075 (+) True LOC110496287
TU1774246 other downstream 27192 42808458 ~ 42808805 (+) True G1550614
TU1774273 other downstream 108362 42889628 ~ 42952382 (+) False LOC110496322
TU1774282 other downstream 108362 42889628 ~ 42893465 (+) False LOC110496322
TU1774303 other downstream 108362 42889628 ~ 42960139 (+) False LOC110496322
TU1774307 other downstream 108362 42889628 ~ 42893465 (+) False LOC110496322

Expression Profile


TU1774211 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU1774211 Expression in each Bioproject

Bar chart with 18 bars.
TU1774211 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.