RNA id: TU1821361



Basic Information


Item Value
RNA id TU1821361
length 460
RNA type TUCP
GC content 0.43
exon number 1
gene id G1590583
representative True

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 11641407 ~ 11641866 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


catcatggtttgggcctgcttttcttcagcaaggacagggaatatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacccgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatatacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaaattcagtctctcgatgtgcaaaactgatagagacataccccaagcgatttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggt

Function


GO: NA

KEGG:

id description

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1821355 lncRNA downstream 182 11637302 ~ 11641225 (-) True G1590579
TU1821484 lncRNA downstream 8598 11632497 ~ 11632809 (-) True G1590703
TU1821360 lncRNA downstream 109162 11530192 ~ 11532245 (-) True G1590582
TU1821366 lncRNA downstream 112837 11526689 ~ 11528570 (-) True G1590588
TU1821419 lncRNA downstream 123770 11517421 ~ 11517637 (-) True G1590640
TU1821489 lncRNA upstream 11153 11653019 ~ 11653467 (-) True G1590706
TU1821493 lncRNA upstream 16000 11657866 ~ 11658187 (-) True G1590709
TU1821496 lncRNA upstream 22298 11664164 ~ 11664363 (-) True G1590712
TU1821503 lncRNA upstream 33264 11675130 ~ 11675357 (-) True G1590719
TU1821505 lncRNA upstream 35298 11677164 ~ 11677513 (-) True G1590721
XM_036954286.1 mRNA downstream 78412 11548405 ~ 11562995 (-) True LOC110497372
XM_021573448.2 mRNA downstream 78463 11548405 ~ 11562944 (-) False LOC110497372
XM_036954287.1 mRNA downstream 80276 11548405 ~ 11561131 (-) False LOC110497372
XR_005037660.1 mRNA downstream 99334 11532264 ~ 11542073 (-) True LOC118941455
XM_036954284.1 mRNA downstream 429281 11115879 ~ 11212126 (-) False LOC110497368
XM_021573113.2 mRNA upstream 2691 11644557 ~ 11742079 (-) False mra
NM_001124483.1 mRNA upstream 3314 11645180 ~ 11742064 (-) False mra
XM_036953678.1 mRNA upstream 24864 11666730 ~ 11742079 (-) True mra
XM_036954304.1 mRNA upstream 291154 11933020 ~ 12082009 (-) False LOC110497375
XM_036954303.1 mRNA upstream 291154 11933020 ~ 12187983 (-) False LOC110497375
TU1820805 other downstream 370589 11270516 ~ 11270818 (-) True G1590098
TU1820712 other downstream 463290 11124388 ~ 11178117 (-) True LOC110497368
TU1819455 other downstream 1495838 10136860 ~ 10145569 (-) True LOC110498432
TU1818382 other downstream 2673103 8967296 ~ 8968304 (-) True LOC118941443
TU1818317 other downstream 2687731 8902855 ~ 8953676 (-) False G1588003
TU1822015 other upstream 435852 12077718 ~ 12126489 (-) False LOC110497375
TU1822002 other upstream 554229 12196095 ~ 12204414 (-) True LOC110497375
TU1822206 other upstream 609925 12251791 ~ 12252528 (-) True G1591322
TU1823437 other upstream 1584303 13226169 ~ 13239190 (-) True LOC110497387
TU1824132 other upstream 2183693 13825559 ~ 13827241 (-) False G1593032

Expression Profile


TU1821361 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU1821361 Expression in each Bioproject

Bar chart with 20 bars.
TU1821361 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.