RNA id: TU1826921



Basic Information


Item Value
RNA id TU1826921
length 366
RNA type TUCP
GC content 0.51
exon number 1
gene id G1595424
representative True

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 14483425 ~ 14483790 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


agatggatggggccatgtatcgcgagatcttggccaacaacctccttccctcattaagagcattgaagatgggtcgtggctgggtcttccagcatgacaatgacccgaaacacacagccagggcaactaaggagtggctccataagaagcatctcaaggtcctggagtggcctagccagtctccagacctgaacccaatagaacatatttggagggagctgaaagtccgtattgcccagcgacagtcccgaaacctgaaggatctggagaaggtctttatggaggagtgggccaaaatccctgctgcagtgtgtgcaaacctggtcaagaactacaggaaacgtatgatctctgttattgcaaaca

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1826919 lncRNA downstream 4837 14477885 ~ 14478588 (-) True G1595423
TU1826917 lncRNA downstream 7851 14475338 ~ 14475574 (-) True G1595421
TU1826887 lncRNA downstream 70729 14412216 ~ 14412696 (-) True G1595391
TU1824785 lncRNA downstream 119788 14362399 ~ 14363637 (-) True G1593629
TU1824746 lncRNA downstream 166990 14316195 ~ 14316435 (-) True G1593594
TU1826929 lncRNA upstream 5546 14489336 ~ 14489572 (-) True G1595428
TU1826933 lncRNA upstream 11146 14494936 ~ 14495579 (-) True G1595432
TU1826934 lncRNA upstream 12219 14496009 ~ 14498266 (-) True G1595433
TU1826935 lncRNA upstream 16898 14500688 ~ 14500994 (-) True G1595434
TU1826939 lncRNA upstream 22696 14506486 ~ 14506776 (-) True G1595438
XM_021573482.2 mRNA downstream 539384 13883312 ~ 13944041 (-) False vegfc
XM_021573480.2 mRNA downstream 658587 13814235 ~ 13824838 (-) True LOC110497394
XM_021573481.2 mRNA downstream 660102 13814235 ~ 13823323 (-) False LOC110497394
XM_036954325.1 mRNA downstream 661628 13814235 ~ 13821797 (-) False LOC110497394
XM_021573477.2 mRNA downstream 728655 13672694 ~ 13754770 (-) False LOC110497393
XM_036954336.1 mRNA upstream 407975 14891765 ~ 14935660 (-) False LOC110497396
XM_036954337.1 mRNA upstream 407975 14891765 ~ 14936266 (-) True LOC110497396
XM_021573485.2 mRNA upstream 508720 14992510 ~ 14997435 (-) True LOC110497398
XM_036954340.1 mRNA upstream 519062 15002852 ~ 15016671 (-) True LOC110498656
trnak-cuu-76 mRNA upstream 519505 15003295 ~ 15003367 (-) True trnak-cuu-76
TU1824132 other downstream 656184 13825559 ~ 13827241 (-) False G1593032
TU1823437 other downstream 1244235 13226169 ~ 13239190 (-) True LOC110497387
TU1822206 other downstream 2230897 12251791 ~ 12252528 (-) True G1591322
TU1822002 other downstream 2279011 12196095 ~ 12204414 (-) True LOC110497375
TU1822015 other downstream 2356936 12077718 ~ 12126489 (-) False LOC110497375
TU1827387 other upstream 776102 15259892 ~ 15260731 (-) True LOC110498659
TU1827710 other upstream 1316463 15800253 ~ 15901185 (-) True G1596136
TU1827886 other upstream 1541137 16024927 ~ 16025915 (-) False G1596285
TU1827302 other upstream 1695800 16179590 ~ 16180684 (-) True LOC110498490
TU1828138 other upstream 1919041 16402831 ~ 16403473 (-) True G1596503

Expression Profile


TU1826921 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU1826921 Expression in each Bioproject

Bar chart with 18 bars.
TU1826921 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.