RNA id: TU1856873



Basic Information


Item Value
RNA id TU1856873
length 605
lncRNA type inter_gene
GC content 0.51
exon number 1
gene id G1622772
representative True

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 38927707 ~ 38928311 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tgtttcgattgggttcaaatctgggctctggctgggccactcaaggacattcagagacttgtcccgaagcaactcctgcgttgtcttggctgtgtgcttagggtcgttgtcctgttggaaggggaaccttcaccccagtctgaggtcctgagcactctgaaacaggttatcatcaaggacctctctctactttgctccgttcatctttgcctcgaccctgactactctcacagtccctgccactgaaaaacatccccacagcatgacgctgccaccaccatgcttcaccgtagggatggtatcaggtttcctccagatgtgacgcttggcattcaggccaaagagttcaatcttggtttcatcagaccagagaatcttgtttctcatggtctgagagtgttttaggtgaattttggcaaacttcaagcgggctgtcatgtgccttttactgaggagtggcttctgtctgggccactctactacaaatgcctgattggtgaagtgctgcagagatggttgtctttctggaagtttctcccatctccacagaagaactctggagctctgtcagagtggccatcaggttcttggtcacctccaggacc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1856872 lncRNA downstream 84 38927407 ~ 38927623 (-) True G1622771
TU1856865 lncRNA downstream 16481 38910945 ~ 38911226 (-) True G1622764
TU1856864 lncRNA downstream 17137 38910282 ~ 38910570 (-) True G1622763
TU1856766 lncRNA downstream 77367 38846752 ~ 38850340 (-) True G1622673
TU1856808 lncRNA downstream 97317 38827895 ~ 38830390 (-) True G1622712
TU1856876 lncRNA upstream 2990 38931301 ~ 38932352 (-) True G1622775
TU1856875 lncRNA upstream 7043 38935354 ~ 38936670 (-) True lrit3b
TU1856886 lncRNA upstream 75519 39003830 ~ 39005396 (-) True G1622784
TU1857011 lncRNA upstream 243397 39171708 ~ 39171949 (-) True G1622892
TU1857042 lncRNA upstream 267176 39195487 ~ 39196095 (-) True G1622914
XM_021574155.2 mRNA downstream 796 38911281 ~ 38926911 (-) True LOC110497791
XM_021574154.2 mRNA downstream 28886 38892389 ~ 38898821 (-) True LOC110497790
XM_021574150.2 mRNA downstream 165547 38709218 ~ 38762160 (-) True LOC110497787
XM_036954749.1 mRNA downstream 253460 38654186 ~ 38674247 (-) True LOC110497783
XM_036954748.1 mRNA downstream 273674 38648007 ~ 38654033 (-) True dapp1
XM_036953845.1 mRNA upstream 7104 38935415 ~ 38939516 (-) False lrit3b
XM_036953846.1 mRNA upstream 7104 38935415 ~ 38939611 (-) False lrit3b
NM_001160648.2 mRNA upstream 57486 38985797 ~ 38988755 (-) True ampm1
XM_021574171.2 mRNA upstream 296379 39224690 ~ 39230702 (-) False enpp4
XM_036954769.1 mRNA upstream 296379 39224690 ~ 39231092 (-) True enpp4
TU1853281 other downstream 2159008 36654523 ~ 36768699 (-) True LOC110497753
TU1852753 other downstream 2522371 36401554 ~ 36405336 (-) True G1619119
TU1851431 other downstream 3530924 35392860 ~ 35396783 (-) True LOC110498336
TU1849241 other downstream 5448271 33478593 ~ 33479436 (-) True G1615810
TU1849224 other downstream 5514490 33412219 ~ 33413217 (-) True G1615793
TU1856858 other upstream 28713 38957024 ~ 38958974 (-) True G1622757
TU1857173 other upstream 436946 39365257 ~ 39370266 (-) False si:dkey-229e3.2
TU1857216 other upstream 467757 39396068 ~ 39411784 (-) False G1623037
TU1857211 other upstream 473745 39402056 ~ 39411784 (-) False G1623037
TU1857214 other upstream 476481 39404792 ~ 39411784 (-) False G1623037

Expression Profile


TU1856873 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU1856873 Expression in each Bioproject

Bar chart with 21 bars.
TU1856873 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.