RNA id: TU1857823



Basic Information


Item Value
RNA id TU1857823
length 230
lncRNA type inter_gene
GC content 0.44
exon number 1
gene id G1623544
representative True

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 40273535 ~ 40273764 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CCCCACTCAACACACACGCCCTCTTACTAGGGGATGGTTTGGTTCCATCGTTGATACCTATTGGCCAACCTGGTTTTGTTTCGTTGATTTGGTTGGTTGTCCTTAACAATGCTTGAATCCTCCGAAACCAGCGACATGTTTCTTTGAGTTCGTAAGTATCTCTCGTCAATGAATCGTTCAAGCTCTTCAATGGATTCTGAATCATCCAGCAGAGTTAAGCACACAAACAA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1857818 lncRNA upstream 2951 40270186 ~ 40270584 (+) True G1623539
TU1857816 lncRNA upstream 3468 40269853 ~ 40270067 (+) True G1623537
TU1857802 lncRNA upstream 14386 40258885 ~ 40259149 (+) True G1623523
TU1856627 lncRNA upstream 80747 40192575 ~ 40192788 (+) True G1622547
TU1856611 lncRNA upstream 100573 40172744 ~ 40172962 (+) True G1622531
TU1857840 lncRNA downstream 7623 40281387 ~ 40281634 (+) True G1623561
TU1857857 lncRNA downstream 18339 40292103 ~ 40292379 (+) True G1623575
TU1857868 lncRNA downstream 43561 40317325 ~ 40362584 (+) True G1623579
TU1857864 lncRNA downstream 80118 40353882 ~ 40356016 (+) True G1623578
TU1857929 lncRNA downstream 118836 40392600 ~ 40396042 (+) True G1623624
LOC110498349 mRNA upstream 171144 40099735 ~ 40102391 (+) True LOC110498349
XM_021573115.2 mRNA upstream 317230 39919756 ~ 39956305 (+) False erb2
XM_021574261.2 mRNA downstream 192143 40465907 ~ 40468723 (+) False LOC110497836
XM_021574260.2 mRNA downstream 192252 40466016 ~ 40468723 (+) True LOC110497836
XM_021574265.2 mRNA downstream 271152 40544916 ~ 40553190 (+) True LOC110497840
XM_021574266.2 mRNA downstream 285515 40559279 ~ 40562442 (+) True LOC110497841
XM_021574279.2 mRNA downstream 433837 40707601 ~ 40757224 (+) False LOC110497848
TU1856516 other upstream 211194 40051939 ~ 40062341 (+) False G1622452
TU1858342 other downstream 710333 40984097 ~ 40987824 (+) True plk4
TU1858638 other downstream 1170757 41444521 ~ 41446361 (+) False G1624239
TU1858642 other downstream 1170757 41444521 ~ 41446361 (+) True G1624239
TU1858990 other downstream 1736197 42009961 ~ 42010330 (+) True G1624560
TU1858971 other downstream 1750844 42024608 ~ 42029506 (+) True tmem260

Expression Profile


TU1857823 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU1857823 Expression in each Bioproject

Bar chart with 13 bars.
TU1857823 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.