RNA id: TU1860906



Basic Information


Item Value
RNA id TU1860906
length 825
RNA type TUCP
GC content 0.46
exon number 1
gene id G1626232
representative True

Chromosome Information


Item Value
chromosome id NC_048583.1
NCBI id CM023237.2
chromosome length 67237266
location 42640449 ~ 42641273 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tggcccgtgggccaaatttggcccgcggggtaattatatttggcccgcgagacaataccaaattactactagagctggcccgccggtattatacagcgcattcaccactaatactacgaatcccataatgctctgctgtttttgcgcgccaatcaggacaggacccagaaatgctctctcctctgtgacagtagtcatagcaacatagacgctacaactgtcagcgagctaacccttcccaaaaatggcgaaaagaaaggcagaaaacaggagctttctggacaagtgggaggcagaatatctgtttacatatgtaaaagacaaacctgtttgtcttgtttgtggattcaacgtggctgtaagtaaggagtacaacattagacgacactatgaaacgaaacaccatgacaaatacaaggacctggacatgactcaaaggagccagaaagtagaggagatgaaaagaagtttggtttcacaacagaatatgtttaaaaaagccacatcacaaagcgaggatcacagacatgtacgctgcagtgagggccttcaaaactaaactgtgcctgtgggagaatcagatgctgcaagaaaacccttgccattttccctgctgccaatccataaaagcgcagatctctaccgccgtgttcccatgcgcacagtttgctgaaaaactcaatgttctcgccgctgagtttagccggcgatttgccgacttcgatgcccagaaatgcaagtttgaactgcttagtaatcccttcgcagttgatgtggaaaatgcaccaaccaacatccaaatggagctgattgaactccagtgca

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1860944 lncRNA downstream 49138 42590982 ~ 42591311 (-) True G1626267
TU1860905 lncRNA downstream 51581 42586935 ~ 42588868 (-) True G1626231
TU1860929 lncRNA downstream 75047 42564355 ~ 42565402 (-) True G1626254
TU1860886 lncRNA downstream 153475 42486722 ~ 42486974 (-) True G1626212
TU1860880 lncRNA downstream 160511 42476118 ~ 42479938 (-) True LOC110498355
TU1860970 lncRNA upstream 6316 42647589 ~ 42647792 (-) True G1626288
TU1860973 lncRNA upstream 8857 42650130 ~ 42650687 (-) True G1626291
TU1860976 lncRNA upstream 13236 42654509 ~ 42655253 (-) True G1626294
TU1860978 lncRNA upstream 15082 42656355 ~ 42657840 (-) True G1626296
TU1860979 lncRNA upstream 16635 42657908 ~ 42664575 (-) True G1626297
XM_021574383.2 mRNA downstream 35685 42601758 ~ 42604764 (-) True LOC110497915
XR_002469743.2 mRNA downstream 68992 42570828 ~ 42571457 (-) True LOC110497913
XM_021574374.2 mRNA downstream 78480 42494458 ~ 42561969 (-) False eml5
XM_036954865.1 mRNA downstream 78480 42494458 ~ 42561969 (-) False eml5
XM_036954866.1 mRNA downstream 78480 42494458 ~ 42561969 (-) True eml5
XM_021574396.2 mRNA upstream 27763 42669036 ~ 42671065 (-) False erg28
XM_036954869.1 mRNA upstream 27763 42669036 ~ 42671081 (-) False erg28
XM_021574394.2 mRNA upstream 123604 42764877 ~ 42786064 (-) True tgfb3
XM_036953847.1 mRNA upstream 458952 43100225 ~ 43110498 (-) True LOC110498358
XM_036954879.1 mRNA upstream 484161 43125434 ~ 43132494 (-) False LOC110497926
TU1860882 other downstream 169747 42465825 ~ 42470702 (-) False LOC110498355
TU1860762 other downstream 384652 42255235 ~ 42255797 (-) True G1626105
TU1859988 other downstream 790016 41846255 ~ 41850433 (-) True G1625428
TU1859580 other downstream 1445690 41194433 ~ 41194759 (-) True G1625066
TU1859566 other downstream 1478037 41144107 ~ 41162412 (-) True LOC110497865
TU1861008 other upstream 118021 42759294 ~ 42838434 (-) True G1626324
TU1861812 other upstream 767454 43408727 ~ 43409109 (-) True G1627068
TU1865759 other upstream 3362492 46003765 ~ 46005877 (-) False LOC110498001
TU1866141 other upstream 3977934 46619207 ~ 46629506 (-) False G1631005
TU1866265 other upstream 4189061 46830334 ~ 46830650 (-) True G1631120

Expression Profile


TU1860906 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

TU1860906 Expression in each Bioproject

Bar chart with 20 bars.
TU1860906 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.