RNA id: TCONS_00049946


Basic Information

Item Value
RNA id TCONS_00049946
length 79
RNA type miRNA
GC content 0.43
exon number 1
gene id XLOC_025303
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 23673377 ~ 23673455 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTCTGTGATTTAGGTAGTTTCAAGTTGTTGGGCTGGACGTTTAATTTCACAGGAACCTGAAACTGCCTGAATTGCTCCA

Function

GO:

id name namespace
GO:0033339 pectoral fin development biological_process
GO:0035195 gene silencing by miRNA biological_process

KEGG:

id description
ko03100 Non-coding RNAs

ZFIN:

id description
ZDB-MIRNAG-081212-1 Acts upstream of or within gene silencing by miRNA and pectoral fin development. Is expressed in neural tube and tail bud.

Ensembl:

ensembl_id ENSDART00000116761

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00052661 lncRNA upstream 5180 23665161 ~ 23668197 (+) False XLOC_025301
TCONS_00052662 lncRNA upstream 5180 23666387 ~ 23668197 (+) True XLOC_025301
TCONS_00052660 lncRNA upstream 56576 23604478 ~ 23616801 (+) True XLOC_025299
TCONS_00052656 lncRNA upstream 148727 23517959 ~ 23524650 (+) False XLOC_025298
TCONS_00052657 lncRNA upstream 148990 23518132 ~ 23524387 (+) False XLOC_025298
TCONS_00049952 lncRNA downstream 20701 23694156 ~ 23696208 (+) True XLOC_025306
TCONS_00052663 lncRNA downstream 256991 23930446 ~ 23967966 (+) False XLOC_025313
TCONS_00049968 lncRNA downstream 261437 23934892 ~ 23967966 (+) False XLOC_025313
TCONS_00052664 lncRNA downstream 261486 23934941 ~ 23965038 (+) False XLOC_025313
TCONS_00052665 lncRNA downstream 261509 23934964 ~ 23962671 (+) True XLOC_025313
TCONS_00049945 mRNA upstream 1514 23669267 ~ 23671863 (+) True XLOC_025302
TCONS_00049944 mRNA upstream 17543 23654233 ~ 23655834 (+) True XLOC_025300
TCONS_00049943 mRNA upstream 177154 23488652 ~ 23496223 (+) True XLOC_025297
TCONS_00049941 mRNA upstream 325293 23248542 ~ 23348084 (+) False XLOC_025295
TCONS_00049940 mRNA upstream 338908 23248542 ~ 23334469 (+) False XLOC_025295
TCONS_00049947 mRNA downstream 3896 23677351 ~ 23682436 (+) True XLOC_025304
TCONS_00049948 mRNA downstream 14454 23687909 ~ 23690481 (+) True XLOC_025305
TCONS_00049949 mRNA downstream 18392 23691847 ~ 23695980 (+) False XLOC_025306
TCONS_00049950 mRNA downstream 19007 23692462 ~ 23695866 (+) False XLOC_025306
TCONS_00049953 mRNA downstream 24542 23697997 ~ 23749910 (+) False XLOC_025307
TCONS_00049938 other upstream 433919 23235668 ~ 23239458 (+) True XLOC_025294
TCONS_00049913 other upstream 1104271 22568987 ~ 22569106 (+) True XLOC_025283
TCONS_00049893 other upstream 1612289 22059313 ~ 22061088 (+) False XLOC_025275
TCONS_00049877 other upstream 2642504 21025153 ~ 21030873 (+) True XLOC_025264
TCONS_00049876 other upstream 2642506 21025153 ~ 21030871 (+) False XLOC_025264
TCONS_00049951 other downstream 20701 23694156 ~ 23696013 (+) False XLOC_025306
TCONS_00049958 other downstream 47196 23720651 ~ 23720745 (+) True XLOC_025311
TCONS_00049974 other downstream 421705 24095160 ~ 24101082 (+) True XLOC_025315
TCONS_00049975 other downstream 422502 24095957 ~ 24096036 (+) True XLOC_025316
TCONS_00049977 other downstream 461102 24134557 ~ 24137908 (+) True XLOC_025318