RNA id: TCONS_00050085


Basic Information

Item Value
RNA id TCONS_00050085
length 487
RNA type processed_transcript
GC content 0.48
exon number 3
gene id XLOC_025389
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 27071749 ~ 27277695 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAGATCACTGAAAAAAGCAGAAGAACCACGCCGCGAAGGGTTAAAGCTTCACAACCGAGTTCCAGAGAGGCTGTGGGGAAAGAGGACTGTGAGACTGTCCTGTGGTCCTGCTTGCAGATTCAGTCCCATTTTCTTGCGGATTCAGTTTCCAACGTTCGAGTCTCGCGGTCCTTCTCATCGAGGAAGAGTCATGGATAATTCATAAACATGCAAACCACTGGATTAATTTGATTCGCATGGTTCTGTGGTTGAACTTCAAGGATTCGTCGGTGGGAATAATTATCCATATTTTCAACCTGGCTGGTGAGAGGAGGACTGTTGCAATGTCATCCCATTCAACATCTCTGGAGCTTTGTGGAAGAGGGATGCTTATATCGTCGGGCCTGTGAGCTTCCTCCGCTCAGTCACTCCAAGAGTCTTCATGTGATGATGTCAGCTCCACTCTCTTCTGCCCTGCTTGCTGCTCAGATCCAGTGTCACATGTAAT

Function

GO:

id name namespace
GO:0060079 excitatory postsynaptic potential biological_process
GO:0006811 ion transport biological_process
GO:0060291 long-term synaptic potentiation biological_process
GO:0098839 postsynaptic density membrane cellular_component
GO:0045202 synapse cellular_component
GO:0005886 plasma membrane cellular_component
GO:0017146 NMDA selective glutamate receptor complex cellular_component
GO:0045211 postsynaptic membrane cellular_component
GO:0030054 cell junction cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0038023 signaling receptor activity molecular_function
GO:0015276 ligand-gated ion channel activity molecular_function
GO:0005216 ion channel activity molecular_function
GO:0004970 ionotropic glutamate receptor activity molecular_function
GO:0004972 NMDA glutamate receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070424-129 Predicted to enable NMDA glutamate receptor activity. Predicted to be involved in excitatory postsynaptic potential and long-term synaptic potentiation. Predicted to act upstream of or within ion transport. Predicted to be located in postsynaptic membrane. Predicted to be integral component of membrane. Predicted to be part of NMDA selective glutamate receptor complex. Predicted to be active in postsynaptic density membrane. Is expressed in retina. Human ortholog(s) of this gene implicated in Huntington's disease; bipolar disorder; and schizophrenia. Orthologous to human GRIN2A (glutamate ionotropic receptor NMDA type subunit 2A).

Ensembl:

ensembl_id ENSDART00000151001

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00050083 lncRNA upstream 17424 27052190 ~ 27054349 (+) True XLOC_025388
TCONS_00050078 lncRNA upstream 328548 26742409 ~ 26743225 (+) True XLOC_025385
TCONS_00052678 lncRNA upstream 435375 26635820 ~ 26636398 (+) True XLOC_025384
TCONS_00052677 lncRNA upstream 654989 26411233 ~ 26416784 (+) True XLOC_025383
TCONS_00052676 lncRNA upstream 709975 26355294 ~ 26361798 (+) True XLOC_025382
TCONS_00052679 lncRNA downstream 220176 27294308 ~ 27340431 (+) False XLOC_025390
TCONS_00052682 lncRNA downstream 220176 27294308 ~ 27343644 (+) False XLOC_025390
TCONS_00052681 lncRNA downstream 220176 27294308 ~ 27343644 (+) False XLOC_025390
TCONS_00052680 lncRNA downstream 220176 27294308 ~ 27343644 (+) False XLOC_025390
TCONS_00052342 lncRNA downstream 220176 27294308 ~ 27343644 (+) False XLOC_025390
TCONS_00050082 mRNA upstream 15593 27027781 ~ 27056180 (+) False XLOC_025388
TCONS_00050081 mRNA upstream 165422 26905024 ~ 26906351 (+) True XLOC_025387
TCONS_00050079 mRNA upstream 256820 26813058 ~ 26814953 (+) False XLOC_025386
TCONS_00050080 mRNA upstream 257102 26814030 ~ 26814671 (+) True XLOC_025386
TCONS_00050077 mRNA upstream 319954 26734162 ~ 26751819 (+) False XLOC_025385
TCONS_00050091 mRNA downstream 532373 27606505 ~ 27640823 (+) False XLOC_025394
TCONS_00050092 mRNA downstream 533136 27607268 ~ 27642128 (+) False XLOC_025394
TCONS_00050094 mRNA downstream 567949 27642081 ~ 27663447 (+) True XLOC_025394
TCONS_00050095 mRNA downstream 590732 27664864 ~ 27694673 (+) False XLOC_025395
TCONS_00050096 mRNA downstream 590732 27664864 ~ 27709312 (+) False XLOC_025395
TCONS_00050071 other upstream 752719 26310494 ~ 26319054 (+) True XLOC_025378
TCONS_00050060 other upstream 877314 26194344 ~ 26194459 (+) True XLOC_025374
TCONS_00050056 other upstream 920213 26144765 ~ 26151560 (+) False XLOC_025372
TCONS_00050021 other upstream 1939542 25126456 ~ 25132231 (+) True XLOC_025346
TCONS_00049977 other upstream 2933865 24134557 ~ 24137908 (+) True XLOC_025318
TCONS_00050090 other downstream 332964 27407096 ~ 27407211 (+) True XLOC_025392
TCONS_00050119 other downstream 1757386 28831518 ~ 28850434 (+) False XLOC_025404
TCONS_00050124 other downstream 1787044 28861176 ~ 28866082 (+) True XLOC_025405
TCONS_00050129 other downstream 2092888 29167020 ~ 29167147 (+) True XLOC_025410
TCONS_00050143 other downstream 2566862 29640994 ~ 29654697 (+) False XLOC_025418

Expression Profile

//