RNA id: XR_005037984.1



Basic Information


Item Value
RNA id XR_005037984.1
length 406
RNA type mRNA
GC content 0.48
exon number 4
gene id LOC110499354
representative True

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 33474940 ~ 33517443 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GCCACATTTAGGGTCCAGAGGTTTTCCTTAACATGTGAACCAACCACATCTAGGGCCCAGAGGTTTTTCTTAACTGGTGAACCAACCACATCTAGGGCCCAGAGGTTTTCCTTAACCCAGCCACATTTAGGGTCCAGAGGTTTTCCTTAACATGTGAACCAACCACATCTAGGGCCCAGAGGTTTTTCTTAACTGGTGAACCAACCACATCTAGGGCCCAGAGGTTTTCCTTAACCCAGCCACATTTAGGGTCCAGAGGTTTTCCTTAACATGTGAACCAACCACATCTAGGGCCCAGAGGTTTTTCTTAACTGGTGAACCAACCACATCTAGGGCCCAGAGGTTTTCCTTAACCCAGCCACATTTAGGGTCCAGAGGTTTTCCTTAACATGTGAACCAACCACAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1929305 lncRNA upstream 14504 33460602 ~ 33460804 (+) True G1686748
TU1929302 lncRNA upstream 20385 33454699 ~ 33454923 (+) True G1686745
TU1929287 lncRNA upstream 20662 33425854 ~ 33454646 (+) True G1686730
TU1929279 lncRNA upstream 67723 33407186 ~ 33407585 (+) True G1686724
TU1929268 lncRNA upstream 102733 33372041 ~ 33372575 (+) True G1686713
TU1929330 lncRNA downstream 11177 33528620 ~ 33530380 (+) False LOC118942063
TU1929331 lncRNA downstream 11177 33528620 ~ 33529154 (+) False LOC118942063
TU1929332 lncRNA downstream 11177 33528620 ~ 33530380 (+) False LOC118942063
TU1929335 lncRNA downstream 11177 33528620 ~ 33530380 (+) True LOC118942063
TU1929311 lncRNA downstream 16236 33533679 ~ 33559019 (+) False G1686753
XM_021576436.2 mRNA upstream 213174 33216272 ~ 33262134 (+) False LOC110499352
XR_005037982.1 mRNA upstream 279141 33185064 ~ 33196167 (+) False LOC118942060
XM_036956206.1 mRNA upstream 342483 33063035 ~ 33132825 (+) True LOC110499532
XM_021576428.2 mRNA upstream 611919 32849697 ~ 32863389 (+) True LOC110499344
XM_036956203.1 mRNA upstream 715261 32747591 ~ 32760047 (+) True LOC110499341
XR_005037983.1 mRNA downstream 11355 33528798 ~ 33529479 (+) False LOC118942063
XR_005037988.1 mRNA downstream 143878 33661321 ~ 33787514 (+) False LOC110499362
XM_036956221.1 mRNA downstream 144151 33661594 ~ 33775767 (+) False LOC110499362
XM_036956222.1 mRNA downstream 144151 33661594 ~ 33775767 (+) True LOC110499362
XM_036956223.1 mRNA downstream 432309 33949752 ~ 33958728 (+) False rab23
TU1929194 other upstream 290032 33177293 ~ 33185276 (+) True LOC118942060
TU1928807 other upstream 813660 32654354 ~ 32661648 (+) True G1686317
TU1924589 other upstream 3898750 29572435 ~ 29576558 (+) False LOC110499316
TU1924591 other upstream 3898750 29574758 ~ 29576558 (+) True LOC110499316
TU1924556 other upstream 4017387 29457228 ~ 29457921 (+) True lhcgr
TU1930380 other downstream 808394 34325837 ~ 34326254 (+) True G1687675
TU1932015 other downstream 1864266 35381709 ~ 35384566 (+) False LOC110499396
TU1932017 other downstream 1864266 35381709 ~ 35384566 (+) False LOC110499396
TU1932215 other downstream 2163924 35681367 ~ 35682437 (+) True G1689347
TU1932214 other downstream 2183777 35701220 ~ 35702139 (+) True LOC118942012

Expression Profile


XR_005037984.1 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

XR_005037984.1 Expression in each Bioproject

Bar chart with 9 bars.
XR_005037984.1 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7.
End of interactive chart.