RNA id: TCONS_00050170


Basic Information

Item Value
RNA id TCONS_00050170
length 90
RNA type snoRNA
GC content 0.46
exon number 1
gene id XLOC_025435
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 30694174 ~ 30695807 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACGCTTCAGTGATGTTTAGCACTGGGCTCTGAGTTCATGTGTAGACAAAAGTGCAGTTTTGCTCTTGACATGGCAGAACCTGAGAAGTGT

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0016070 RNA metabolic process biological_process
GO:0016072 rRNA metabolic process biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0071840 cellular component organization or biogenesis biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0006396 RNA processing biological_process
GO:0030490 maturation of SSU-rRNA biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0044238 primary metabolic process biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0042255 ribosome assembly biological_process
GO:0000469 cleavage involved in rRNA processing biological_process
GO:0000470 maturation of LSU-rRNA biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0042274 ribosomal small subunit biogenesis biological_process
GO:0000478 endonucleolytic cleavage involved in rRNA processing biological_process
GO:0000479 endonucleolytic cleavage of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0071704 organic substance metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0090501 RNA phosphodiester bond hydrolysis biological_process
GO:0090502 RNA phosphodiester bond hydrolysis, endonucleolytic biological_process
GO:0030684 preribosome cellular_component
GO:0030686 90S preribosome cellular_component
GO:0030688 preribosome, small subunit precursor cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044428 obsolete nuclear part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0044452 obsolete nucleolar part cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0005634 nucleus cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0031981 nuclear lumen cellular_component
GO:0043226 organelle cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0005730 nucleolus cellular_component
GO:0034511 U3 snoRNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0030515 snoRNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0003723 RNA binding molecular_function

KEGG:

id description
ko00230 Purine metabolism
ko00240 Pyrimidine metabolism
ko03020 RNA polymerase
ko03230 Viral genome structure
ko05164 Influenza A
ko05169 Epstein-Barr virus infection
ko05016 Huntington disease
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000115479

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00052707 lncRNA upstream 39225 30643162 ~ 30655558 (+) True XLOC_025434
TCONS_00052706 lncRNA upstream 188634 30497721 ~ 30506149 (+) True XLOC_025432
TCONS_00050167 lncRNA upstream 192857 30501039 ~ 30501926 (+) True XLOC_025433
TCONS_00050165 lncRNA upstream 339196 30354768 ~ 30355587 (+) True XLOC_025431
TCONS_00052705 lncRNA upstream 341528 30317853 ~ 30353255 (+) True XLOC_025430
TCONS_00052711 lncRNA downstream 173546 30868418 ~ 30873160 (+) True XLOC_025436
TCONS_00052348 lncRNA downstream 213020 30907892 ~ 30908126 (+) True XLOC_025437
TCONS_00052712 lncRNA downstream 248416 30943288 ~ 30948454 (+) True XLOC_025439
TCONS_00050177 lncRNA downstream 345086 31039958 ~ 31042100 (+) True XLOC_025442
TCONS_00050181 lncRNA downstream 403061 31097933 ~ 31105653 (+) False XLOC_025446
TCONS_00050166 mRNA upstream 190364 30500968 ~ 30504419 (+) False XLOC_025433
TCONS_00050161 mRNA upstream 376188 30257582 ~ 30318595 (+) False XLOC_025430
TCONS_00050163 mRNA upstream 377129 30257718 ~ 30317654 (+) False XLOC_025430
TCONS_00050162 mRNA upstream 377332 30257710 ~ 30317451 (+) False XLOC_025430
TCONS_00050159 mRNA upstream 494226 30190419 ~ 30200557 (+) True XLOC_025428
TCONS_00050171 mRNA downstream 226374 30921246 ~ 30926321 (+) False XLOC_025438
TCONS_00050172 mRNA downstream 228075 30922947 ~ 30927002 (+) True XLOC_025438
TCONS_00050173 mRNA downstream 273304 30968176 ~ 30975502 (+) False XLOC_025440
TCONS_00050174 mRNA downstream 274011 30968883 ~ 30974043 (+) True XLOC_025440
TCONS_00050175 mRNA downstream 285980 30980852 ~ 30988333 (+) True XLOC_025441
TCONS_00050160 other upstream 445747 30248739 ~ 30249036 (+) True XLOC_025429
TCONS_00050148 other upstream 1039858 29654160 ~ 29654925 (+) True XLOC_025418
TCONS_00050146 other upstream 1039862 29642200 ~ 29654921 (+) False XLOC_025418
TCONS_00050143 other upstream 1040086 29640994 ~ 29654697 (+) False XLOC_025418
TCONS_00050147 other upstream 1045625 29648122 ~ 29649158 (+) False XLOC_025418
TCONS_00050187 other downstream 905776 31600648 ~ 31603704 (+) True XLOC_025451
TCONS_00050194 other downstream 1093649 31788521 ~ 31788637 (+) True XLOC_025455
TCONS_00050246 other downstream 1837724 32532596 ~ 32535126 (+) False XLOC_025485
TCONS_00050254 other downstream 1876437 32571309 ~ 32571371 (+) True XLOC_025487
TCONS_00050265 other downstream 1967119 32661991 ~ 32663746 (+) False XLOC_025493