RNA id: TU1903362



Basic Information


Item Value
RNA id TU1903362
length 476
RNA type TUCP
GC content 0.46
exon number 1
gene id G1663264
representative True

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 11542616 ~ 11543091 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


caagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaacttttaggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggcttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaa

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1903358 lncRNA downstream 3373 11536901 ~ 11539243 (-) True G1663261
TU1903311 lncRNA downstream 94549 11447847 ~ 11448067 (-) True G1663221
TU1903244 lncRNA downstream 196554 11345325 ~ 11346062 (-) True G1663159
TU1903194 lncRNA downstream 263524 11278746 ~ 11279092 (-) True G1663128
TU1903057 lncRNA downstream 270461 11263195 ~ 11272155 (-) True LOC110511226
TU1903363 lncRNA upstream 553 11543644 ~ 11544011 (-) True G1663265
TU1903364 lncRNA upstream 2159 11545250 ~ 11545600 (-) True G1663266
TU1903392 lncRNA upstream 81961 11625052 ~ 11625724 (-) True fshr
TU1903437 lncRNA upstream 98104 11641195 ~ 11641407 (-) True G1663311
TU1903442 lncRNA upstream 108873 11651964 ~ 11653118 (-) False G1663314
XM_021575705.2 mRNA downstream 33351 11498540 ~ 11509265 (-) True LOC110498965
XM_021575706.2 mRNA downstream 44228 11492053 ~ 11498388 (-) False LOC110498966
XM_036955770.1 mRNA downstream 44228 11492053 ~ 11498388 (-) True LOC110498966
trnai-uau-46 mRNA downstream 55011 11487511 ~ 11487605 (-) True trnai-uau-46
XM_036955769.1 mRNA downstream 59081 11458919 ~ 11483535 (-) False LOC110498963
XM_021575711.2 mRNA upstream 4352 11547443 ~ 11549694 (-) True LOC110498969
XM_036955773.1 mRNA upstream 12168 11555259 ~ 11564924 (-) True LOC110498968
XM_021575718.2 mRNA upstream 60151 11603242 ~ 11616988 (-) False LOC110498972
XM_021575719.2 mRNA upstream 60151 11603242 ~ 11617187 (-) False LOC110498972
XM_021575717.2 mRNA upstream 60151 11603242 ~ 11619571 (-) False LOC110498972
TU1903036 other downstream 383840 11122065 ~ 11158776 (-) True LOC110498953
TU1903031 other downstream 418905 11121913 ~ 11123711 (-) False LOC110498953
TU1901981 other downstream 1065431 10476963 ~ 10477185 (-) True G1662039
TU1900917 other downstream 2082501 9422783 ~ 9460115 (-) True G1661001
TU1900940 other downstream 2141669 9399117 ~ 9400947 (-) True G1661023
TU1904421 other upstream 707059 12250150 ~ 12251106 (-) False G1664239
TU1905723 other upstream 1858190 13401281 ~ 13407377 (-) True G1665402
TU1907060 other upstream 2679108 14222199 ~ 14223019 (-) True G1666656
TU1907198 other upstream 2881882 14424973 ~ 14425314 (-) True G1666788
TU1907305 other upstream 3081264 14624355 ~ 14634440 (-) True LOC110499033

Expression Profile


TU1903362 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU1903362 Expression in each Bioproject

Bar chart with 19 bars.
TU1903362 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.