RNA id: TCONS_00050216


Basic Information

Item Value
RNA id TCONS_00050216
length 279
RNA type mRNA
GC content 0.48
exon number 2
gene id XLOC_025469
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 32129632 ~ 32130455 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGAGACTTGTCAGATTCGCCAGAACTACGATCGTGACTGCGAGGCTGCGATCAACAAGATGATCAATCTGGAGCTTTACGCTGGATACACCTACACCTCCATGGCTCACTACTTCAAACGGGACGATGTGGCCCTTCCTGGATTTGCCAAGTTCTTCAATAAGAACAGCGAGGAGGAGCGCGAACATGCTGAGAAATTCATGGAGTTCCAGAACAAGAGAGGTGGACGCATTGTCCTTCAGGACATCAAGGTGCTTTTCCTGTCATGTATTATTTAA

Function

GO:

id name namespace
GO:0006879 cellular iron ion homeostasis biological_process
GO:0006880 intracellular sequestering of iron ion biological_process
GO:0006826 iron ion transport biological_process
GO:0005737 cytoplasm cellular_component
GO:0005506 iron ion binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0008198 ferrous iron binding molecular_function
GO:0008199 ferric iron binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-428 Predicted to enable ferric iron binding activity and ferrous iron binding activity. Predicted to be involved in intracellular sequestering of iron ion. Predicted to act upstream of or within cellular iron ion homeostasis and iron ion transport. Predicted to be active in cytoplasm.

Ensembl:

ensembl_id ENSDART00000174522

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00050213 lncRNA upstream 9539 32118677 ~ 32120093 (+) False XLOC_025467
TCONS_00052718 lncRNA upstream 28993 32099699 ~ 32100639 (+) False XLOC_025464
TCONS_00050208 lncRNA upstream 28993 32099699 ~ 32100639 (+) False XLOC_025464
TCONS_00050209 lncRNA upstream 29009 32099701 ~ 32100623 (+) True XLOC_025464
TCONS_00052717 lncRNA upstream 210501 31918162 ~ 31919131 (+) True XLOC_025458
TCONS_00052719 lncRNA downstream 163318 32293773 ~ 32297003 (+) True XLOC_025473
TCONS_00052720 lncRNA downstream 215679 32346134 ~ 32347493 (+) True XLOC_025475
TCONS_00050222 lncRNA downstream 259105 32389560 ~ 32390332 (+) False XLOC_025476
TCONS_00050230 lncRNA downstream 281030 32411485 ~ 32414843 (+) False XLOC_025478
TCONS_00050231 lncRNA downstream 281423 32411878 ~ 32414843 (+) True XLOC_025478
TCONS_00050215 mRNA upstream 2049 32125452 ~ 32127583 (+) True XLOC_025468
TCONS_00050212 mRNA upstream 9278 32118670 ~ 32120354 (+) False XLOC_025467
TCONS_00050214 mRNA upstream 9492 32118807 ~ 32120140 (+) True XLOC_025467
TCONS_00050211 mRNA upstream 15984 32112004 ~ 32113648 (+) True XLOC_025466
TCONS_00050210 mRNA upstream 22960 32105175 ~ 32106672 (+) True XLOC_025465
TCONS_00050217 mRNA downstream 4582 32135037 ~ 32136228 (+) True XLOC_025470
TCONS_00050218 mRNA downstream 9211 32139666 ~ 32140446 (+) True XLOC_025471
TCONS_00050219 mRNA downstream 11927 32142382 ~ 32151167 (+) True XLOC_025472
TCONS_00050220 mRNA downstream 211462 32341917 ~ 32345900 (+) True XLOC_025474
TCONS_00050221 mRNA downstream 235356 32365811 ~ 32401481 (+) False XLOC_025476
TCONS_00050194 other upstream 340995 31788521 ~ 31788637 (+) True XLOC_025455
TCONS_00050187 other upstream 525928 31600648 ~ 31603704 (+) True XLOC_025451
TCONS_00050170 other upstream 1434760 30694783 ~ 30694872 (+) True XLOC_025435
TCONS_00050160 other upstream 1880596 30248739 ~ 30249036 (+) True XLOC_025429
TCONS_00050148 other upstream 2474707 29654160 ~ 29654925 (+) True XLOC_025418
TCONS_00050246 other downstream 402141 32532596 ~ 32535126 (+) False XLOC_025485
TCONS_00050254 other downstream 440854 32571309 ~ 32571371 (+) True XLOC_025487
TCONS_00050265 other downstream 531536 32661991 ~ 32663746 (+) False XLOC_025493
TCONS_00050268 other downstream 540735 32671190 ~ 32671963 (+) False XLOC_025494
TCONS_00050288 other downstream 712339 32842794 ~ 32848026 (+) False XLOC_025502

Expression Profile

//