RNA id: TCONS_00050229


Basic Information

Item Value
RNA id TCONS_00050229
length 571
RNA type mRNA
GC content 0.47
exon number 6
gene id XLOC_025478
representative False

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 32410746 ~ 32416121 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGCACTTTTGTATGAAACAGAGATGTGTTTATGGCGTGATATCGGTGTAGTAATTATTACATCGTACTTTGTGTCTGACTACGACCCAACCATTGAAGACTCTTACACTAAAATCTGCACCGTGGACGGGAAGGAGACACGATTAGACATCCTCGACACAGCAGGGCAAGAGGAGTTTGGAGCCATGAGAGAGCAGTACATGCGCTCTGGAGAGGGCTTCTTACTGGTGTTTGCTCTTAATGACAGTGGCAGTTATAACGAAATTCAGAAATTTCACACTCAGATATTACGGGTTAAGGATCGAGATGACTTTCCTATGGTTCTTGTTGGCAACAAATCAGATCTTGACCAGCAGAGAGTGATCTCAAAAGAGGAAGCCATGACGTTTGCCCGAGAAAACAGGATCCACTATATGGAATCATCAGCCAAGAACCGTCACAACGTGGATGAAGCCTTCATGGAGGTTGTGCGAGCAATAAGGAAGTTTCAGGAGACAGAGAGTCCACCGCTTCCCGCTAATCATACAGGGAAGCAGAAGAGTGGTGGCTGTCCCTGCACCCTACTCTGACTG

Function

GO:

id name namespace
GO:0007219 Notch signaling pathway biological_process
GO:0007265 Ras protein signal transduction biological_process
GO:0045199 maintenance of epithelial cell apical/basal polarity biological_process
GO:0007165 signal transduction biological_process
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function
GO:0019003 GDP binding molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG:

id description
ko04010 MAPK signaling pathway
ko04014 Ras signaling pathway
ko04015 Rap1 signaling pathway
ko04371 Apelin signaling pathway
ko04072 Phospholipase D signaling pathway
ko04024 cAMP signaling pathway
ko04140 Autophagy - animal
ko04137 Mitophagy - animal
ko04218 Cellular senescence
ko04810 Regulation of actin cytoskeleton
ko04625 C-type lectin receptor signaling pathway
ko04360 Axon guidance
ko05205 Proteoglycans in cancer
ko05132 Salmonella infection
ko04031 GTP-binding proteins

ZFIN:

id description
ZDB-GENE-041010-217 Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Acts upstream of or within Notch signaling pathway and maintenance of epithelial cell apical/basal polarity. Predicted to be located in membrane. Predicted to be active in plasma membrane. Is expressed in hindbrain and somite. Orthologous to human RRAS (RAS related).

Ensembl:

ensembl_id ENSDART00000141793

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00050222 lncRNA upstream 21113 32389560 ~ 32390332 (+) False XLOC_025476
TCONS_00052720 lncRNA upstream 63952 32346134 ~ 32347493 (+) True XLOC_025475
TCONS_00052719 lncRNA upstream 114442 32293773 ~ 32297003 (+) True XLOC_025473
TCONS_00050213 lncRNA upstream 291352 32118677 ~ 32120093 (+) False XLOC_025467
TCONS_00050209 lncRNA upstream 310822 32099701 ~ 32100623 (+) True XLOC_025464
TCONS_00050237 lncRNA downstream 5779 32420320 ~ 32424231 (+) True XLOC_025479
TCONS_00050240 lncRNA downstream 60120 32474661 ~ 32477285 (+) True XLOC_025481
TCONS_00050249 lncRNA downstream 118371 32532912 ~ 32535695 (+) False XLOC_025485
TCONS_00052721 lncRNA downstream 118371 32532912 ~ 32536378 (+) False XLOC_025485
TCONS_00050250 lncRNA downstream 120072 32534613 ~ 32536378 (+) True XLOC_025485
TCONS_00050226 mRNA upstream 4253 32403758 ~ 32407192 (+) True XLOC_025477
TCONS_00050221 mRNA upstream 9964 32365811 ~ 32401481 (+) False XLOC_025476
TCONS_00050232 mRNA downstream 2407 32416948 ~ 32424142 (+) False XLOC_025479
TCONS_00050233 mRNA downstream 2439 32416980 ~ 32424298 (+) False XLOC_025479
TCONS_00050234 mRNA downstream 2491 32417032 ~ 32424303 (+) False XLOC_025479
TCONS_00050235 mRNA downstream 2550 32417091 ~ 32424164 (+) False XLOC_025479
TCONS_00050236 mRNA downstream 2567 32417108 ~ 32423780 (+) False XLOC_025479
TCONS_00050194 other upstream 622808 31788521 ~ 31788637 (+) True XLOC_025455
TCONS_00050187 other upstream 807741 31600648 ~ 31603704 (+) True XLOC_025451
TCONS_00050170 other upstream 1716573 30694783 ~ 30694872 (+) True XLOC_025435
TCONS_00050160 other upstream 2162409 30248739 ~ 30249036 (+) True XLOC_025429
TCONS_00050148 other upstream 2756520 29654160 ~ 29654925 (+) True XLOC_025418
TCONS_00050246 other downstream 118055 32532596 ~ 32535126 (+) False XLOC_025485
TCONS_00050254 other downstream 156768 32571309 ~ 32571371 (+) True XLOC_025487
TCONS_00050265 other downstream 247450 32661991 ~ 32663746 (+) False XLOC_025493
TCONS_00050268 other downstream 256649 32671190 ~ 32671963 (+) False XLOC_025494
TCONS_00050288 other downstream 428253 32842794 ~ 32848026 (+) False XLOC_025502

Expression Profile

//