RNA id: TU1915334



Basic Information


Item Value
RNA id TU1915334
length 208
lncRNA type inter_gene
GC content 0.55
exon number 1
gene id G1674065
representative True

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 22196197 ~ 22196404 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cctgaatccaattgagcacatctgggacatcatgtctcgctccatacaccaacgccacgttgtaccacagactgtccaggagttggcggatgctttagtccaggtctgggaggagatccctcaggagaccatccaccacctcatcaggagcatgcccaggcattgtagggaggtcatacaggcacgtggaggccatacacactactga

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1915333 lncRNA upstream 843 22194979 ~ 22195354 (+) True G1674064
TU1915073 lncRNA upstream 145424 22048754 ~ 22050773 (+) True G1673841
TU1915069 lncRNA upstream 151809 22042443 ~ 22044388 (+) True G1673838
TU1915037 lncRNA upstream 222695 21972859 ~ 21973502 (+) True LOC110499590
TU1915010 lncRNA upstream 224904 21968637 ~ 21971293 (+) True G1673783
TU1915310 lncRNA downstream 3714 22200118 ~ 22206985 (+) False G1674044
TU1915311 lncRNA downstream 3714 22200118 ~ 22206985 (+) True G1674044
TU1915465 lncRNA downstream 56929 22253333 ~ 22253731 (+) True G1674190
TU1915531 lncRNA downstream 103785 22300189 ~ 22300408 (+) True G1674254
TU1915536 lncRNA downstream 107616 22304020 ~ 22304231 (+) True G1674259
XM_036955984.1 mRNA upstream 104617 21974338 ~ 22091580 (+) True snx29
XM_021576720.2 mRNA upstream 222002 21972738 ~ 21974195 (+) False LOC110499590
XR_005037964.1 mRNA upstream 236671 21945076 ~ 21959526 (+) False LOC110513322
XM_036955545.1 mRNA downstream 55727 22252131 ~ 22318724 (+) True cpped1
XM_036955992.1 mRNA downstream 64343 22260747 ~ 22281843 (+) False LOC118942051
XM_036955988.1 mRNA downstream 83593 22279997 ~ 22281839 (+) False LOC118942051
XM_036955985.1 mRNA downstream 83593 22279997 ~ 22281843 (+) False LOC118942051
XM_036955986.1 mRNA downstream 83593 22279997 ~ 22281843 (+) False LOC118942051
TU1915004 other upstream 236570 21936642 ~ 21959627 (+) True LOC110513322
TU1914567 other upstream 350331 21833894 ~ 21845866 (+) False tnrc6b
TU1914569 other upstream 382371 21813245 ~ 21813826 (+) False tnrc6b
TU1914368 other upstream 745851 21444883 ~ 21450346 (+) False G1673231
TU1916535 other downstream 1060400 23256804 ~ 23258069 (+) False LOC110499192
TU1916709 other downstream 1383626 23580030 ~ 23581387 (+) False faap100
TU1916707 other downstream 1383733 23580137 ~ 23581387 (+) False faap100
TU1916710 other downstream 1383733 23580137 ~ 23581432 (+) False faap100
TU1916714 other downstream 1383733 23580137 ~ 23581387 (+) True faap100

Expression Profile


TU1915334 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU1915334 Expression in each Bioproject

Bar chart with 17 bars.
TU1915334 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.