RNA id: TCONS_00050266


Basic Information

Item Value
RNA id TCONS_00050266
length 360
RNA type mRNA
GC content 0.42
exon number 4
gene id XLOC_025493
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 32661765 ~ 32669219 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGCAGGAAAAGACTACCACCATCTCTTCAAGCTGCTCATCATTGGTGACTCAAATGTGGGAAAAAGCAGTTTGCTCCTGCGATTTGCAGACAACTCATTCTCTGGGAGTTACATAACCACTATTGGAGTTGACTTCAAGATCCGCACTGTAGAGATTGACGGAGAAAGGGTTAAACTCCAGATCTGGGACACTGCAGGGCAGGAAAGGTTTAGAACTATCACCTCAACGTATTACAGAAACACTCATGGTGTCATCATCGTTTACGATGTCACAAACCCTGAATCATTTGTCAATGTGAAAAGATGGTTAAATGAGATCTCGCAAAACTGTGACAATGTCTGCAAAATTTTAGGTTAG

Function

GO:

id name namespace
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-141219-36 Predicted to enable GTP binding activity and GTPase activity.

Ensembl:

ensembl_id ENSDART00000190240

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00052723 lncRNA upstream 122 32661766 ~ 32663743 (+) False XLOC_025493
TCONS_00052722 lncRNA upstream 6732 32651697 ~ 32657133 (+) False XLOC_025492
TCONS_00050261 lncRNA upstream 6732 32651697 ~ 32657133 (+) False XLOC_025492
TCONS_00050263 lncRNA upstream 7986 32651717 ~ 32655879 (+) True XLOC_025492
TCONS_00052721 lncRNA upstream 127487 32532912 ~ 32536378 (+) False XLOC_025485
TCONS_00052724 lncRNA downstream 4239 32671190 ~ 32675311 (+) False XLOC_025494
TCONS_00050269 lncRNA downstream 4617 32671568 ~ 32675311 (+) True XLOC_025494
TCONS_00050272 lncRNA downstream 19035 32685986 ~ 32686666 (+) True XLOC_025495
TCONS_00050276 lncRNA downstream 40189 32707140 ~ 32708110 (+) True XLOC_025497
TCONS_00050281 lncRNA downstream 82735 32749686 ~ 32772217 (+) True XLOC_025499
TCONS_00050262 mRNA upstream 5429 32651697 ~ 32658436 (+) False XLOC_025492
TCONS_00050260 mRNA upstream 13587 32631372 ~ 32650278 (+) True XLOC_025491
TCONS_00050259 mRNA upstream 34376 32620575 ~ 32629489 (+) True XLOC_025490
TCONS_00050257 mRNA upstream 44231 32594357 ~ 32619634 (+) False XLOC_025489
TCONS_00050267 mRNA downstream 4195 32671146 ~ 32680126 (+) False XLOC_025494
TCONS_00050270 mRNA downstream 14323 32681274 ~ 32688592 (+) False XLOC_025495
TCONS_00050271 mRNA downstream 14358 32681309 ~ 32689328 (+) False XLOC_025495
TCONS_00050273 mRNA downstream 22756 32689707 ~ 32696592 (+) False XLOC_025496
TCONS_00050274 mRNA downstream 24324 32691275 ~ 32695237 (+) True XLOC_025496
TCONS_00050265 other upstream 119 32661991 ~ 32663746 (+) False XLOC_025493
TCONS_00050254 other upstream 92494 32571309 ~ 32571371 (+) True XLOC_025487
TCONS_00050246 other upstream 128739 32532596 ~ 32535126 (+) False XLOC_025485
TCONS_00050194 other upstream 875228 31788521 ~ 31788637 (+) True XLOC_025455
TCONS_00050187 other upstream 1060161 31600648 ~ 31603704 (+) True XLOC_025451
TCONS_00050268 other downstream 4239 32671190 ~ 32671963 (+) False XLOC_025494
TCONS_00050288 other downstream 175843 32842794 ~ 32848026 (+) False XLOC_025502
TCONS_00050297 other downstream 378932 33045883 ~ 33048390 (+) True XLOC_025508
TCONS_00050301 other downstream 678396 33345347 ~ 33363031 (+) False XLOC_025512
TCONS_00050303 other downstream 678519 33345470 ~ 33378643 (+) False XLOC_025512

Expression Profile

//