RNA id: TU1926885



Basic Information


Item Value
RNA id TU1926885
length 224
lncRNA type sense_over
GC content 0.44
exon number 2
gene id G1684565
representative True

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 30936633 ~ 30956023 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactaatagagacataccccaagcgacttacagctgtaatcgcagaaaaaggtggcgctacaaagtattaactta

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1926838 lncRNA downstream 59830 30876510 ~ 30876803 (-) True G1684526
TU1926817 lncRNA downstream 100620 30835635 ~ 30836013 (-) True G1684507
TU1926814 lncRNA downstream 109014 30825799 ~ 30827619 (-) True G1684504
TU1926693 lncRNA downstream 298921 30637282 ~ 30637712 (-) True G1684390
TU1926128 lncRNA downstream 351617 30584797 ~ 30585016 (-) True G1683904
TU1926923 lncRNA upstream 33587 30989610 ~ 31044901 (-) False G1684590
TU1926914 lncRNA upstream 63322 31019345 ~ 31044576 (-) False G1684590
TU1926926 lncRNA upstream 63322 31019345 ~ 31039176 (-) True G1684590
TU1926989 lncRNA upstream 127725 31083748 ~ 31085290 (-) True G1684646
TU1927005 lncRNA upstream 144419 31100442 ~ 31100817 (-) True G1684657
XM_036956177.1 mRNA downstream 102803 30608566 ~ 30833830 (-) False LOC110498787
XM_036956178.1 mRNA downstream 102803 30608566 ~ 30833830 (-) False LOC110498787
XM_036956179.1 mRNA downstream 102804 30608566 ~ 30833829 (-) False LOC110498787
XM_036956180.1 mRNA downstream 102804 30608566 ~ 30833829 (-) False LOC110498787
XM_036955549.1 mRNA downstream 627369 30271979 ~ 30309264 (-) True LOC110498786
XM_036956185.1 mRNA upstream 778833 31734856 ~ 31806658 (-) False LOC110499326
XM_036956186.1 mRNA upstream 778833 31734856 ~ 31806658 (-) False LOC110499326
XM_036956193.1 mRNA upstream 1187486 32143509 ~ 32225826 (-) False LOC110499330
XM_021576410.2 mRNA upstream 1187486 32143509 ~ 32226222 (-) False LOC110499330
XM_036956192.1 mRNA upstream 1187486 32143509 ~ 32226222 (-) True LOC110499330
TU1925354 other downstream 1390316 29541315 ~ 29546317 (-) False LOC110499315
TU1927010 other upstream 155532 31111555 ~ 31113686 (-) True G1684661
TU1927277 other upstream 451571 31407594 ~ 31412844 (-) True G1684920
TU1928979 other upstream 1855684 32811707 ~ 32812854 (-) True LOC110499342
TU1929489 other upstream 2121787 33077810 ~ 33078027 (-) True G1686887
TU1929645 other upstream 2577650 33533673 ~ 33534276 (-) True LOC110499358

Expression Profile


TU1926885 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU1926885 Expression in each Bioproject

Bar chart with 18 bars.
TU1926885 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.