RNA id: TU1937838



Basic Information


Item Value
RNA id TU1937838
length 278
lncRNA type intronic
GC content 0.48
exon number 2
gene id G1694235
representative True

Chromosome Information


Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 40280386 ~ 40281198 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CATTCACTGAGGTAGCAGATAGCCCATTCACTGAGGTAGCAGACAGCCTAGTCTATTCACTGAGGTAGCAGACAGCCTAGTCTATTCACTGAGGTAGCAGACAGCCTAGTCTATTCACTAGGTAGCAGACAGCCTAGTCTATTCACTGAGGTAGCAGACAGCCTAGTATATTCACTGAGGTAGCAGACAGCCTAGTCTATTCACTGAGGTAGCAGACAGCCTAGTCTATTCACTGAGGTAGCAGATAGCCTAGTCTATTCACTGAGGTAGCAGACAGC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1937790 lncRNA downstream 20319 40216857 ~ 40260067 (-) True G1694194
TU1937815 lncRNA downstream 26419 40253175 ~ 40253967 (-) True G1694213
TU1937798 lncRNA downstream 56657 40222338 ~ 40223729 (-) True G1694198
TU1937765 lncRNA downstream 143644 40135881 ~ 40136742 (-) True G1694169
TU1937755 lncRNA downstream 165121 40114928 ~ 40115265 (-) True G1694160
TU1937840 lncRNA upstream 3377 40284575 ~ 40285447 (-) True G1694237
TU1937845 lncRNA upstream 10462 40291660 ~ 40292152 (-) True G1694240
TU1937842 lncRNA upstream 11088 40292286 ~ 40293748 (-) True G1694239
TU1937886 lncRNA upstream 21582 40302780 ~ 40303854 (-) True G1694265
TU1937893 lncRNA upstream 42883 40324081 ~ 40324287 (-) True G1694272
XM_021576607.2 mRNA downstream 480240 39797003 ~ 39800146 (-) True LOC110499470
XM_021575346.2 mRNA downstream 584540 39688079 ~ 39695846 (-) True comtd1
XM_021575347.2 mRNA downstream 584636 39688079 ~ 39695750 (-) False comtd1
XM_021575348.2 mRNA downstream 585007 39688079 ~ 39695379 (-) False comtd1
XM_021575345.2 mRNA downstream 585172 39688079 ~ 39695214 (-) False comtd1
XM_036956336.1 mRNA upstream 50467 40331665 ~ 40346338 (-) False LOC110499472
XM_036956337.1 mRNA upstream 50467 40331665 ~ 40350083 (-) True LOC110499472
XM_036956339.1 mRNA upstream 76042 40357240 ~ 40398282 (-) False LOC110499553
XM_036956338.1 mRNA upstream 76042 40357240 ~ 40399083 (-) False LOC110499553
XM_036956340.1 mRNA upstream 76042 40357240 ~ 40399083 (-) False LOC110499553
TU1937667 other downstream 166260 40111355 ~ 40114126 (-) False LOC100301650
TU1937670 other downstream 166260 40111355 ~ 40114126 (-) True LOC100301650
TU1937015 other downstream 612072 39665311 ~ 39668314 (-) False LOC110499466
TU1937007 other downstream 612146 39665264 ~ 39668240 (-) False LOC110499466
TU1937876 other upstream 110984 40392182 ~ 40399046 (-) True LOC110499553
TU1937847 other upstream 214692 40495890 ~ 40497807 (-) True LOC110499548
TU1938298 other upstream 632196 40913394 ~ 40914130 (-) True G1694632
TU1938419 other upstream 731976 41013174 ~ 41013994 (-) True G1694739
TU1938443 other upstream 772721 41053919 ~ 41055566 (-) True G1694757

Expression Profile


TU1937838 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU1937838 Expression in each Bioproject

Bar chart with 7 bars.
TU1937838 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.