RNA id: TCONS_00050656


Basic Information

Item Value
RNA id TCONS_00050656
length 583
RNA type mRNA
GC content 0.48
exon number 3
gene id XLOC_025783
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 55114097 ~ 55114874 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACAGCACTCTTCAGCTTCTGTTTAAGACACTTAGTCTGAACATCTAAAGTCGAAAACATGGTTGTGTGGACAGACTTCGAGAAGGCCACCATTCAAGATATCTTCGCCAAGGCTGACTACGACGTCATCGGTCCTCAGGCTCTGGCAAGGTGTCTCATCGTGTACCCCTGGACTCAGCGGTACTTCGCCAAGTTTGGAAACCTCTACAATGCCGCTGCCATCCTGGGAAACCCAATGGTTGCTGCCCACGGTAAAACTGTGCTCAAGGGTCTGGAGCTGGCAGTGAAGAACATGGACAACATCAAGGCCACCTATGCTGATTTAAGTGTGCTGCACTCCGAGAAGCTCCACGTAGATCCCGACAACTTCAGGCTTTTGGCTGATTGCTTGACCATCGTTGTTGCTGCTCAGATGGGTGCTGGATTCACACCTGAAGTTCAGGCCGCTTTCCAGAAATTCATCGCTGTCGCCGTGTCCGCTCTGGGAAGACAGTACCACTAAATACAGACAGAGAGAGATTATAATGTTTCCACTAAAGAATGTGCTATTCTGAGTTGAAGCAAATAAATATTTCACTATTCAA

Function

GO:

id name namespace
GO:0016999 antibiotic metabolic process biological_process
GO:0017001 antibiotic catabolic process biological_process
GO:0042743 hydrogen peroxide metabolic process biological_process
GO:0030154 cell differentiation biological_process
GO:0042744 hydrogen peroxide catabolic process biological_process
GO:0006942 regulation of striated muscle contraction biological_process
GO:0051187 obsolete cofactor catabolic process biological_process
GO:0048856 anatomical structure development biological_process
GO:0048869 cellular developmental process biological_process
GO:0015669 gas transport biological_process
GO:0015671 oxygen transport biological_process
GO:0032502 developmental process biological_process
GO:0048066 developmental pigmentation biological_process
GO:0030318 melanocyte differentiation biological_process
GO:0030900 forebrain development biological_process
GO:0072593 reactive oxygen species metabolic process biological_process
GO:0044445 obsolete cytosolic part cellular_component
GO:0031838 haptoglobin-hemoglobin complex cellular_component
GO:0005833 hemoglobin complex cellular_component
GO:0016684 oxidoreductase activity, acting on peroxide as acceptor molecular_function
GO:0043565 sequence-specific DNA binding molecular_function
GO:0019825 oxygen binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0046906 tetrapyrrole binding molecular_function
GO:0004601 peroxidase activity molecular_function
GO:0016209 antioxidant activity molecular_function
GO:0140104 molecular carrier activity molecular_function
GO:0043177 organic acid binding molecular_function
GO:0005344 oxygen carrier activity molecular_function
GO:0031720 haptoglobin binding molecular_function
GO:0020037 heme binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030616-7 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Predicted to be involved in hydrogen peroxide catabolic process. Predicted to act upstream of or within oxygen transport. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Is expressed in several structures, including ball; hematopoietic cell; hematopoietic system; mesoderm; and vasculature.

Ensembl:

ensembl_id ENSDART00000121686

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00052804 lncRNA upstream 277580 54834509 ~ 54836517 (+) True XLOC_025776
TCONS_00052802 lncRNA upstream 777458 54332726 ~ 54336639 (+) False XLOC_025769
TCONS_00052803 lncRNA upstream 777458 54332747 ~ 54336639 (+) True XLOC_025769
TCONS_00052801 lncRNA upstream 810473 54289678 ~ 54303624 (+) True XLOC_025768
TCONS_00052384 lncRNA upstream 829912 54283767 ~ 54284185 (+) True XLOC_025767
TCONS_00050657 lncRNA downstream 7788 55122662 ~ 55123322 (+) False XLOC_025784
TCONS_00052805 lncRNA downstream 271341 55386215 ~ 55387657 (+) True XLOC_025788
TCONS_00052806 lncRNA downstream 367246 55482120 ~ 55488241 (+) False XLOC_025789
TCONS_00050663 lncRNA downstream 367267 55482141 ~ 55488241 (+) False XLOC_025789
TCONS_00052807 lncRNA downstream 367304 55482178 ~ 55488241 (+) False XLOC_025789
TCONS_00050654 mRNA upstream 8131 55105066 ~ 55105966 (+) True XLOC_025782
TCONS_00050653 mRNA upstream 13161 55100045 ~ 55100936 (+) True XLOC_025781
TCONS_00050652 mRNA upstream 19698 55093581 ~ 55094399 (+) True XLOC_025780
TCONS_00050651 mRNA upstream 70947 55031685 ~ 55043150 (+) True XLOC_025779
TCONS_00050650 mRNA upstream 220391 54887782 ~ 54893706 (+) True XLOC_025778
TCONS_00050658 mRNA downstream 7788 55122662 ~ 55123439 (+) True XLOC_025784
TCONS_00050659 mRNA downstream 16415 55131289 ~ 55132052 (+) True XLOC_025785
TCONS_00050660 mRNA downstream 173326 55288200 ~ 55290630 (+) False XLOC_025786
TCONS_00050661 mRNA downstream 173328 55288202 ~ 55290637 (+) True XLOC_025786
TCONS_00050667 mRNA downstream 1048402 56163276 ~ 56342119 (+) False XLOC_025792
TCONS_00050635 other upstream 1046458 54067523 ~ 54067639 (+) True XLOC_025764
TCONS_00050620 other upstream 2285091 52828912 ~ 52829006 (+) True XLOC_025751
TCONS_00050613 other upstream 2493922 52620058 ~ 52620175 (+) True XLOC_025746
TCONS_00050578 other upstream 5038907 50069595 ~ 50075190 (+) False XLOC_025717
TCONS_00050573 other upstream 5981620 49132341 ~ 49132477 (+) True XLOC_025709
TCONS_00050662 other downstream 184169 55299043 ~ 55299158 (+) True XLOC_025787
TCONS_00050664 other downstream 368639 55483513 ~ 55483647 (+) True XLOC_025789
TCONS_00050682 other downstream 2521500 57636374 ~ 57639448 (+) False XLOC_025808
TCONS_00050688 other downstream 2711065 57825939 ~ 57829919 (+) True XLOC_025812
TCONS_00050692 other downstream 2883116 57997990 ~ 57998559 (+) False XLOC_025817

Expression Profile

//