RNA id: TCONS_00050664


Basic Information

Item Value
RNA id TCONS_00050664
length 135
RNA type snoRNA
GC content 0.47
exon number 1
gene id XLOC_025789
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 55482120 ~ 55488241 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAGCACTGTCTTTGAACCTGTGTAGCCCATCCATGGCTCAGCGGGCCAAGCAACAGTGCAACAGTAAAGGGTTGTTATAACTGGAGCCCCTTGGCTTTTCTTCCCAAGTTGCTCTTTTAAAAGCAACCTACAAAT

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0016070 RNA metabolic process biological_process
GO:0016072 rRNA metabolic process biological_process
GO:0001732 formation of cytoplasmic translation initiation complex biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0065003 protein-containing complex assembly biological_process
GO:0071840 cellular component organization or biogenesis biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006396 RNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0006412 translation biological_process
GO:0006413 translational initiation biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0043933 protein-containing complex subunit organization biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0044238 primary metabolic process biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0002181 cytoplasmic translation biological_process
GO:0002183 cytoplasmic translational initiation biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0071013 catalytic step 2 spliceosome cellular_component
GO:0030684 preribosome cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044428 obsolete nuclear part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0005852 eukaryotic translation initiation factor 3 complex cellular_component
GO:0030532 small nuclear ribonucleoprotein complex cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0005634 nucleus cellular_component
GO:0033290 eukaryotic 48S preinitiation complex cellular_component
GO:0016282 eukaryotic 43S preinitiation complex cellular_component
GO:0005685 U1 snRNP cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0097525 spliceosomal snRNP complex cellular_component
GO:0031981 nuclear lumen cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0070993 translation preinitiation complex cellular_component
GO:0005730 nucleolus cellular_component
GO:0008135 translation factor activity, RNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0030515 snoRNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003743 translation initiation factor activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko05169 Epstein-Barr virus infection
ko05016 Huntington disease
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000117075

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00052805 lncRNA upstream 95856 55386215 ~ 55387657 (+) True XLOC_025788
TCONS_00050657 lncRNA upstream 360191 55122662 ~ 55123322 (+) False XLOC_025784
TCONS_00050655 lncRNA upstream 368756 55114097 ~ 55114757 (+) False XLOC_025783
TCONS_00052804 lncRNA upstream 646996 54834509 ~ 54836517 (+) True XLOC_025776
TCONS_00052802 lncRNA upstream 1146874 54332726 ~ 54336639 (+) False XLOC_025769
TCONS_00052808 lncRNA downstream 163226 55646873 ~ 55654264 (+) True XLOC_025790
TCONS_00050665 lncRNA downstream 615609 56099256 ~ 56107909 (+) True XLOC_025791
TCONS_00052385 lncRNA downstream 875035 56358682 ~ 56360650 (+) True XLOC_025793
TCONS_00050672 lncRNA downstream 1091012 56574659 ~ 56581029 (+) True XLOC_025795
TCONS_00050673 lncRNA downstream 1135548 56619195 ~ 56622872 (+) True XLOC_025796
TCONS_00050661 mRNA upstream 192876 55288202 ~ 55290637 (+) True XLOC_025786
TCONS_00050660 mRNA upstream 192883 55288200 ~ 55290630 (+) False XLOC_025786
TCONS_00050659 mRNA upstream 351461 55131289 ~ 55132052 (+) True XLOC_025785
TCONS_00050658 mRNA upstream 360074 55122662 ~ 55123439 (+) True XLOC_025784
TCONS_00050656 mRNA upstream 368639 55114097 ~ 55114874 (+) True XLOC_025783
TCONS_00050667 mRNA downstream 679629 56163276 ~ 56342119 (+) False XLOC_025792
TCONS_00050666 mRNA downstream 679629 56163276 ~ 56342119 (+) False XLOC_025792
TCONS_00050668 mRNA downstream 792699 56276346 ~ 56284122 (+) True XLOC_025792
TCONS_00050669 mRNA downstream 882748 56366395 ~ 56394018 (+) False XLOC_025794
TCONS_00050670 mRNA downstream 893679 56377326 ~ 56393599 (+) True XLOC_025794
TCONS_00050662 other upstream 184355 55299043 ~ 55299158 (+) True XLOC_025787
TCONS_00050635 other upstream 1415874 54067523 ~ 54067639 (+) True XLOC_025764
TCONS_00050620 other upstream 2654507 52828912 ~ 52829006 (+) True XLOC_025751
TCONS_00050613 other upstream 2863338 52620058 ~ 52620175 (+) True XLOC_025746
TCONS_00050578 other upstream 5408323 50069595 ~ 50075190 (+) False XLOC_025717
TCONS_00050682 other downstream 2152727 57636374 ~ 57639448 (+) False XLOC_025808
TCONS_00050688 other downstream 2342292 57825939 ~ 57829919 (+) True XLOC_025812
TCONS_00050692 other downstream 2514343 57997990 ~ 57998559 (+) False XLOC_025817
TCONS_00050699 other downstream 2684876 58168523 ~ 58170414 (+) False XLOC_025821
TCONS_00050717 other downstream 3218673 58702320 ~ 58710755 (+) True XLOC_025845