RNA id: TU1957215



Basic Information


Item Value
RNA id TU1957215
length 229
lncRNA type inter_gene
GC content 0.41
exon number 1
gene id G1708646
representative True

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 12964541 ~ 12964769 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cactcacagggccctacacactcactccatcatctgctcactcacacataatatgcacatacatttatactgattatacacacccactcacatacaagctgctgctactctgtttatcttatatcctgttgcctagtcacctttcccctatacatatctacctccatcacaccagtatccctgcacattataaatatggtattggaactgaccctgtatatagaatact

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1957212 lncRNA upstream 3685 12960461 ~ 12960856 (+) True G1708643
TU1957165 lncRNA upstream 57458 12901283 ~ 12907083 (+) True G1708602
TU1957035 lncRNA upstream 78692 12885644 ~ 12885849 (+) True cmas
TU1957019 lncRNA upstream 121996 12771599 ~ 12842545 (+) True LOC118943029
TU1957029 lncRNA upstream 193154 12770722 ~ 12771387 (+) True G1708492
TU1957219 lncRNA downstream 14362 12979131 ~ 12979348 (+) True G1708650
TU1957220 lncRNA downstream 17009 12981778 ~ 12982204 (+) True G1708651
TU1957221 lncRNA downstream 17720 12982489 ~ 12982769 (+) True G1708652
TU1957260 lncRNA downstream 34681 12999450 ~ 12999709 (+) True G1708674
TU1957275 lncRNA downstream 110160 13074929 ~ 13079923 (+) True G1708683
NM_001124190.1 mRNA upstream 78771 12867488 ~ 12885770 (+) False cmas
XM_036956943.1 mRNA upstream 104173 12844103 ~ 12860368 (+) False LOC118942883
XM_036956948.1 mRNA downstream 6144 12970913 ~ 12974793 (+) True LOC118942885
XM_036956956.1 mRNA downstream 50397 13015166 ~ 13030251 (+) False LOC110490630
XM_036956950.1 mRNA downstream 51078 13015847 ~ 13034215 (+) False LOC110490630
XM_036956953.1 mRNA downstream 51081 13015850 ~ 13034215 (+) False LOC110490630
XM_036956954.1 mRNA downstream 51139 13015908 ~ 13025288 (+) False LOC110490630
TU1957204 other upstream 12026 12951685 ~ 12952515 (+) True G1708635
TU1957013 other upstream 150813 12800768 ~ 12813728 (+) True LOC110490810
TU1957032 other upstream 179039 12784207 ~ 12785502 (+) True G1708495
TU1956882 other upstream 312964 12649686 ~ 12651577 (+) True G1708367
TU1956830 other upstream 380385 12578608 ~ 12584156 (+) True G1708323
TU1957288 other downstream 87764 13052533 ~ 13053969 (+) True LOC110490642
TU1957306 other downstream 135072 13099841 ~ 13101833 (+) True G1708702
TU1957974 other downstream 791417 13756186 ~ 13765456 (+) True G1709276
TU1958014 other downstream 955789 13920558 ~ 13926350 (+) False LOC110499758
TU1958004 other downstream 981876 13946645 ~ 13950916 (+) True LOC110499758

Expression Profile


TU1957215 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU1957215 Expression in each Bioproject

Bar chart with 19 bars.
TU1957215 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.