RNA id: TU1957374



Basic Information


Item Value
RNA id TU1957374
length 266
lncRNA type intronic
GC content 0.35
exon number 2
gene id G1708762
representative True

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 13226452 ~ 13226775 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GGTAACATTATGTTAACCTGATAGAAATAGGTAACATTATGTTAGCCTGATAGCAATAGGTAACATTATGTTAGCCTGATAGCAATAGGTAACATTATGTTAGCCTGATAGCAATAGGTAACATTATGTTAGCCTGATAGCAATAGGTAACATTATGTTAGCCTGATAGCAATAGGCAACATTATGTTAGCCTGATAGCAATAGGCAACATTATGTTAGCCTGATAGCAATAGGTAACATTATGTTAGCCTGATAGAGGTGTAAGG

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1957373 lncRNA upstream 5742 13219975 ~ 13220710 (+) True G1708761
TU1957365 lncRNA upstream 29239 13196916 ~ 13197213 (+) True G1708753
TU1957344 lncRNA upstream 71836 13154298 ~ 13154616 (+) True G1708736
TU1957342 lncRNA upstream 74711 13151536 ~ 13151741 (+) True G1708734
TU1957340 lncRNA upstream 76751 13149378 ~ 13149701 (+) True G1708732
TU1957440 lncRNA downstream 151070 13377845 ~ 13402223 (+) True G1708827
TU1957453 lncRNA downstream 178065 13404840 ~ 13405199 (+) True G1708840
TU1957454 lncRNA downstream 179641 13406416 ~ 13406651 (+) True G1708841
TU1957457 lncRNA downstream 191703 13418478 ~ 13418693 (+) True G1708844
TU1957459 lncRNA downstream 196207 13422982 ~ 13423183 (+) True G1708846
XM_036956971.1 mRNA upstream 152083 13070036 ~ 13074369 (+) False LOC110490647
XR_005038533.1 mRNA upstream 152083 13070036 ~ 13074369 (+) False LOC110490647
XM_036956972.1 mRNA upstream 152083 13070037 ~ 13074369 (+) True LOC110490647
XM_036956967.1 mRNA upstream 159658 13058705 ~ 13066794 (+) True LOC110518396
XM_036956970.1 mRNA upstream 167995 13051847 ~ 13058457 (+) False LOC110490642
XM_021564127.2 mRNA downstream 1023 13227798 ~ 13229394 (+) True LOC110490653
LOC118942887 mRNA downstream 4300 13231075 ~ 13231826 (+) True LOC118942887
XM_036956994.1 mRNA downstream 471742 13698517 ~ 13725137 (+) False LOC110500963
XM_036956480.1 mRNA downstream 512283 13739058 ~ 13748205 (+) False crp
NM_001124725.1 mRNA downstream 512696 13739471 ~ 13748205 (+) False crp
TU1957306 other upstream 124619 13099841 ~ 13101833 (+) True G1708702
TU1957288 other upstream 172483 13052533 ~ 13053969 (+) True LOC110490642
TU1957204 other upstream 273937 12951685 ~ 12952515 (+) True G1708635
TU1957013 other upstream 412724 12800768 ~ 12813728 (+) True LOC110490810
TU1957032 other upstream 440950 12784207 ~ 12785502 (+) True G1708495
TU1957974 other downstream 529411 13756186 ~ 13765456 (+) True G1709276
TU1958014 other downstream 693783 13920558 ~ 13926350 (+) False LOC110499758
TU1958004 other downstream 719870 13946645 ~ 13950916 (+) True LOC110499758
TU1958344 other downstream 839074 14065849 ~ 14066683 (+) True G1709592
TU1958620 other downstream 1307608 14534383 ~ 14537036 (+) True LOC118942889

Expression Profile


TU1957374 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU1957374 Expression in each Bioproject

Bar chart with 9 bars.
TU1957374 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.