RNA id: TU1958086



Basic Information


Item Value
RNA id TU1958086
length 742
lncRNA type intronic
GC content 0.49
exon number 1
gene id G1709363
representative True

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 13945662 ~ 13946403 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tgactctttattcctcctccctcctctattcatcatctcattccttcccctcgttgactctttattcctcctccctcctctattcatcatctcattccttcccctcgttgactctttattcctcctccctcccctcatcatctcattccttcccctcgttgactctttattcctcctccctcctctattcatcatctcattccttcccctcgttgactctttattcctcctccctcctctattcaccatctcattccttcccctcgttgactctttattcctcctccctcccctcatcatctcattccttcccctcgttgactctttattcctcctccctcccctcatcatctcattccttcccctcgttgactctttattcctcctccctcccatcatctcattccttcccctcgttgactctttattcctcctccctcccctcatctcattccttcccctcgttgactctttattcctcctccctcctctattcaccatctcattccttcccctcgttgactctttattcctcctccctcccctcatctcattccttcccctcgttggctctttattcctcctccctcccctcatcatctcattccttcccctcgttagctctttattcctcctccctcccctcatcatctcattccttcccctcgttgactctttattcctcctccctcctctattcatcatctcattccttcccctcgttggctctttattcctcctc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1958085 lncRNA upstream 32 13945302 ~ 13945630 (+) True G1709362
TU1958084 lncRNA upstream 1349 13943718 ~ 13944313 (+) True G1709361
TU1958083 lncRNA upstream 9784 13935487 ~ 13935878 (+) True G1709360
TU1958070 lncRNA upstream 46799 13897847 ~ 13898863 (+) True G1709347
TU1958060 lncRNA upstream 68727 13876484 ~ 13876935 (+) True G1709337
TU1958008 lncRNA downstream 4730 13951133 ~ 13952185 (+) True G1709301
TU1958330 lncRNA downstream 112540 14058943 ~ 14059216 (+) True G1709580
TU1958334 lncRNA downstream 114391 14060794 ~ 14061124 (+) True G1709584
TU1958346 lncRNA downstream 120738 14067141 ~ 14067527 (+) True G1709594
TU1958359 lncRNA downstream 132391 14078794 ~ 14079007 (+) True G1709607
XM_036956480.1 mRNA upstream 197457 13739058 ~ 13748205 (+) False crp
NM_001124725.1 mRNA upstream 197457 13739471 ~ 13748205 (+) False crp
XM_036956479.1 mRNA upstream 197457 13739657 ~ 13748205 (+) True crp
XM_036956994.1 mRNA upstream 220525 13698517 ~ 13725137 (+) False LOC110500963
LOC118942887 mRNA upstream 713836 13231075 ~ 13231826 (+) True LOC118942887
XM_036957009.1 mRNA downstream 40829 13987232 ~ 14006808 (+) False LOC110516615
XM_036957007.1 mRNA downstream 40829 13987232 ~ 14006816 (+) False LOC110516615
XM_036957011.1 mRNA downstream 40829 13987232 ~ 14007450 (+) False LOC110516615
XM_036957010.1 mRNA downstream 40836 13987239 ~ 14006808 (+) False LOC110516615
XM_036957008.1 mRNA downstream 40836 13987239 ~ 14006816 (+) True LOC110516615
TU1958014 other upstream 19312 13920558 ~ 13926350 (+) False LOC110499758
TU1957974 other upstream 180206 13756186 ~ 13765456 (+) True G1709276
TU1957306 other upstream 843829 13099841 ~ 13101833 (+) True G1708702
TU1957288 other upstream 891693 13052533 ~ 13053969 (+) True LOC110490642
TU1957204 other upstream 993147 12951685 ~ 12952515 (+) True G1708635
TU1958004 other downstream 242 13946645 ~ 13950916 (+) True LOC110499758
TU1958344 other downstream 119446 14065849 ~ 14066683 (+) True G1709592
TU1958620 other downstream 587980 14534383 ~ 14537036 (+) True LOC118942889
TU1958665 other downstream 709284 14655687 ~ 14657284 (+) True G1709824
TU1958684 other downstream 733079 14679482 ~ 14682208 (+) True G1709840

Expression Profile


TU1958086 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU1958086 Expression in each Bioproject

Bar chart with 17 bars.
TU1958086 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.