RNA id: TU1961306



Basic Information


Item Value
RNA id TU1961306
length 248
lncRNA type inter_gene
GC content 0.51
exon number 2
gene id G1711908
representative True

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 16980168 ~ 16982189 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gccatggggagtagagaaaacactgccatgggctgtagagaaaacactgccatggggcatagagaaaacactgccatggggcatagagaaaacactgccatgggctgtagagaaaacactgccatggggcatagagaaaacactgccatggggcatagagaaaacactgccatgggctgtagagaaaacactgccatggggagtagagaaaacactgccatggggagtagagaaaacactgccatggg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1961236 lncRNA upstream 6393 16971634 ~ 16973775 (+) True LOC110501009
TU1961301 lncRNA upstream 24474 16955457 ~ 16955694 (+) True G1711904
TU1961299 lncRNA upstream 30291 16949629 ~ 16949877 (+) True G1711902
TU1961295 lncRNA upstream 34541 16945360 ~ 16945627 (+) True G1711898
TU1961252 lncRNA upstream 103464 16876194 ~ 16876704 (+) True G1711858
TU1961307 lncRNA downstream 3489 16985176 ~ 16985412 (+) True G1711909
TU1961309 lncRNA downstream 12243 16993930 ~ 16994129 (+) True G1711911
TU1961310 lncRNA downstream 13039 16994726 ~ 16996423 (+) True G1711912
TU1961239 lncRNA downstream 17922 16999609 ~ 16999854 (+) True G1711845
TU1961315 lncRNA downstream 27596 17009283 ~ 17009574 (+) True G1711917
XM_036957122.1 mRNA upstream 6390 16914013 ~ 16973778 (+) False LOC110501009
XM_036957118.1 mRNA upstream 154239 16762397 ~ 16825929 (+) False LOC110501007
XM_036957123.1 mRNA downstream 20730 17002417 ~ 17063380 (+) False LOC110516649
XM_036957125.1 mRNA downstream 20730 17002417 ~ 17063380 (+) False LOC110516649
XM_036957126.1 mRNA downstream 20730 17002417 ~ 17063380 (+) False LOC110516649
XM_036957127.1 mRNA downstream 20730 17002417 ~ 17063380 (+) False LOC110516649
XM_036957128.1 mRNA downstream 20730 17002417 ~ 17063380 (+) True LOC110516649
TU1961238 other upstream 36379 16914220 ~ 16943789 (+) False LOC110501009
TU1961184 other upstream 238950 16740403 ~ 16741218 (+) False LOC110499863
TU1961166 other upstream 259616 16719920 ~ 16720552 (+) False G1711795
TU1962172 other downstream 684593 17666280 ~ 17668586 (+) True G1712658
TU1962743 other downstream 1284008 18265695 ~ 18267508 (+) True si:dkey-159a18.1
TU1962859 other downstream 1515460 18497147 ~ 18500874 (+) True G1713262
TU1962997 other downstream 1753104 18734791 ~ 18737436 (+) True G1713384
TU1963841 other downstream 2403285 19384972 ~ 19446851 (+) False G1714090

Expression Profile


TU1961306 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU1961306 Expression in each Bioproject

Bar chart with 7 bars.
TU1961306 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.