RNA id: TU1980901



Basic Information


Item Value
RNA id TU1980901
length 234
lncRNA type inter_gene
GC content 0.39
exon number 1
gene id G1729422
representative True

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 33266455 ~ 33266688 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


AAGTAAACCCATACACAGTTCACCATTTTCAACAGTTTCTTCTAAATCAAAAGGAGATGATGGTAATTGCACAGGACGTCAGACTTATTGTCGTTATTATCACACATCAAATGTCTAGACTTTGTTGTTTCCACCATCTTAGCTTCACAGCAAGCACCAGTCTGTCCAACTAAACAGACCACTTAAAGTGCTGTTAGAGGCTTCAAAATACCTCATAACCACTTTCTCCTTTCC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1980900 lncRNA downstream 1923 33264332 ~ 33264532 (-) True G1729421
TU1980748 lncRNA downstream 90960 33175277 ~ 33175495 (-) True G1729276
TU1980647 lncRNA downstream 249434 33016743 ~ 33017021 (-) True G1729181
TU1980589 lncRNA downstream 301058 32931517 ~ 32965397 (-) True G1729127
TU1980609 lncRNA downstream 308727 32953693 ~ 32957728 (-) True G1729143
TU1980903 lncRNA upstream 1992 33268680 ~ 33269155 (-) True G1729424
TU1980914 lncRNA upstream 18001 33284689 ~ 33284916 (-) True G1729435
TU1980921 lncRNA upstream 28587 33295275 ~ 33295580 (-) True G1729442
TU1980922 lncRNA upstream 30665 33297353 ~ 33297606 (-) True G1729443
TU1980923 lncRNA upstream 31352 33298040 ~ 33298317 (-) True G1729444
XM_021577573.2 mRNA downstream 225647 33037901 ~ 33040808 (-) True LOC110500280
XR_005038581.1 mRNA downstream 424510 32834421 ~ 32841945 (-) True LOC118942920
XM_021577563.2 mRNA downstream 498616 32756127 ~ 32767839 (-) False LOC110500274
XR_005038435.1 mRNA upstream 33528 33300216 ~ 33304366 (-) True LOC118942783
LOC110501068 mRNA upstream 1003573 34270261 ~ 34288000 (-) False LOC110501068
LOC118936404 mRNA upstream 1021388 34288076 ~ 34292270 (-) True LOC118936404
XM_021577583.2 mRNA upstream 1025378 34292066 ~ 34295197 (-) True LOC110500287
XM_021577586.2 mRNA upstream 1051584 34318272 ~ 34325044 (-) True LOC110500289
TU1980333 other downstream 661825 32603463 ~ 32604630 (-) True LOC110500269
TU1980113 other downstream 996794 32254847 ~ 32269661 (-) True LOC110500257
TU1980083 other downstream 1097521 32167669 ~ 32168934 (-) True G1728665
TU1978738 other downstream 1666966 31599146 ~ 31599489 (-) True G1727426
TU1978665 other downstream 1774153 31491520 ~ 31492302 (-) True G1727354
TU1982318 other upstream 1003123 34269811 ~ 34273352 (-) True LOC110501068
TU1982316 other upstream 1058537 34325225 ~ 34329576 (-) True G1730761
TU1982420 other upstream 1105589 34372277 ~ 34374679 (-) True LOC110500290
TU1982739 other upstream 1290492 34557180 ~ 34564656 (-) False G1731156
TU1982734 other upstream 1294481 34561169 ~ 34565175 (-) True G1731156

Expression Profile


TU1980901 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU1980901 Expression in each Bioproject

Bar chart with 5 bars.
TU1980901 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.