RNA id: TU1980921



Basic Information


Item Value
RNA id TU1980921
length 306
lncRNA type inter_gene
GC content 0.39
exon number 1
gene id G1729442
representative True

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 33295275 ~ 33295580 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


AAGAAGCCTAGCATTCAGGGGTTCATCAGACAAACTCTTCCAATCAGATAATGGAAACTTCCTAAAAGAGGTTGAATTGCTAGCAAATTTGACCCCATTATGGAAAATCTTCTCAGCAAAATTAAAGATGGAGAGACACATGCTCATTACCTTGGGAAGCGCACACAGAATGAGCTGATATAGATTGTGAGTGACAAGATTCTGGAAGCAATAGTGACTCAAGTAAGAGACTCAAAGTACTTCTTCATCATCTTGGACTGTACACCTGACATTGGTCACCAGGAGAAAATGTAAATTATTCTGAGA

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1980914 lncRNA downstream 10359 33284689 ~ 33284916 (-) True G1729435
TU1980903 lncRNA downstream 26120 33268680 ~ 33269155 (-) True G1729424
TU1980901 lncRNA downstream 28587 33266455 ~ 33266688 (-) True G1729422
TU1980900 lncRNA downstream 30743 33264332 ~ 33264532 (-) True G1729421
TU1980748 lncRNA downstream 119780 33175277 ~ 33175495 (-) True G1729276
TU1980922 lncRNA upstream 1773 33297353 ~ 33297606 (-) True G1729443
TU1980923 lncRNA upstream 2460 33298040 ~ 33298317 (-) True G1729444
TU1980924 lncRNA upstream 3653 33299233 ~ 33299533 (-) True G1729445
TU1980945 lncRNA upstream 25821 33321401 ~ 33321679 (-) True G1729466
TU1980949 lncRNA upstream 29030 33324610 ~ 33324895 (-) True G1729470
XM_021577573.2 mRNA downstream 254467 33037901 ~ 33040808 (-) True LOC110500280
XR_005038581.1 mRNA downstream 453330 32834421 ~ 32841945 (-) True LOC118942920
XM_021577563.2 mRNA downstream 527436 32756127 ~ 32767839 (-) False LOC110500274
XR_005038435.1 mRNA upstream 4636 33300216 ~ 33304366 (-) True LOC118942783
LOC110501068 mRNA upstream 974681 34270261 ~ 34288000 (-) False LOC110501068
LOC118936404 mRNA upstream 992496 34288076 ~ 34292270 (-) True LOC118936404
XM_021577583.2 mRNA upstream 996486 34292066 ~ 34295197 (-) True LOC110500287
XM_021577586.2 mRNA upstream 1022692 34318272 ~ 34325044 (-) True LOC110500289
TU1980333 other downstream 690645 32603463 ~ 32604630 (-) True LOC110500269
TU1980113 other downstream 1025614 32254847 ~ 32269661 (-) True LOC110500257
TU1980083 other downstream 1126341 32167669 ~ 32168934 (-) True G1728665
TU1978738 other downstream 1695786 31599146 ~ 31599489 (-) True G1727426
TU1978665 other downstream 1802973 31491520 ~ 31492302 (-) True G1727354
TU1982318 other upstream 974231 34269811 ~ 34273352 (-) True LOC110501068
TU1982316 other upstream 1029645 34325225 ~ 34329576 (-) True G1730761
TU1982420 other upstream 1076697 34372277 ~ 34374679 (-) True LOC110500290
TU1982739 other upstream 1261600 34557180 ~ 34564656 (-) False G1731156
TU1982734 other upstream 1265589 34561169 ~ 34565175 (-) True G1731156

Expression Profile


TU1980921 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU1980921 Expression in each Bioproject

Bar chart with 18 bars.
TU1980921 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.