RNA id: TU1981956



Basic Information


Item Value
RNA id TU1981956
length 273
lncRNA type inter_gene
GC content 0.33
exon number 1
gene id G1730427
representative True

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 34001988 ~ 34002260 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aatatgtactgtgtaacatgtcatattactgtcatctgatgaagattttcaaaaggttagtgagcgatttattttttaatcctgcgtttgttgattgcatgttttggctattcaaatgagctgtgtctggtggtggtttgacatatatatgtgctatgttttcgccgtaaaacattttagaaatctgacttgctggctagatgaacaaggtgtttatctttcatttgagctattggacttgttaatgtgtggaggttaaatatttttaagaat

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1981913 lncRNA downstream 29528 33971546 ~ 33972460 (-) True G1730384
TU1981910 lncRNA downstream 33257 33968517 ~ 33968731 (-) True G1730381
TU1981902 lncRNA downstream 38331 33963441 ~ 33963657 (-) True G1730373
TU1981884 lncRNA downstream 51034 33950492 ~ 33950954 (-) True G1730355
TU1981882 lncRNA downstream 52102 33949672 ~ 33949886 (-) True G1730353
TU1981957 lncRNA upstream 836 34003096 ~ 34003422 (-) True G1730428
TU1981961 lncRNA upstream 2835 34005095 ~ 34005945 (-) True G1730432
TU1981965 lncRNA upstream 8145 34010405 ~ 34010625 (-) True G1730436
TU1981967 lncRNA upstream 9521 34011781 ~ 34011994 (-) True G1730438
TU1981970 lncRNA upstream 10957 34013217 ~ 34013493 (-) True G1730441
XR_005038435.1 mRNA downstream 697622 33300216 ~ 33304366 (-) True LOC118942783
XM_021577573.2 mRNA downstream 961180 33037901 ~ 33040808 (-) True LOC110500280
XR_005038581.1 mRNA downstream 1160043 32834421 ~ 32841945 (-) True LOC118942920
XM_021577564.2 mRNA downstream 1234149 32756127 ~ 32767839 (-) False LOC110500274
LOC110501068 mRNA upstream 268001 34270261 ~ 34288000 (-) False LOC110501068
LOC118936404 mRNA upstream 285816 34288076 ~ 34292270 (-) True LOC118936404
XM_021577583.2 mRNA upstream 289806 34292066 ~ 34295197 (-) True LOC110500287
XM_021577586.2 mRNA upstream 316012 34318272 ~ 34325044 (-) True LOC110500289
XM_021577589.2 mRNA upstream 369970 34372230 ~ 34376541 (-) False LOC110500290
TU1980333 other downstream 1397358 32603463 ~ 32604630 (-) True LOC110500269
TU1980113 other downstream 1732327 32254847 ~ 32269661 (-) True LOC110500257
TU1980083 other downstream 1833054 32167669 ~ 32168934 (-) True G1728665
TU1978738 other downstream 2402499 31599146 ~ 31599489 (-) True G1727426
TU1978665 other downstream 2509686 31491520 ~ 31492302 (-) True G1727354
TU1982318 other upstream 267551 34269811 ~ 34273352 (-) True LOC110501068
TU1982316 other upstream 322965 34325225 ~ 34329576 (-) True G1730761
TU1982420 other upstream 370017 34372277 ~ 34374679 (-) True LOC110500290
TU1982739 other upstream 554920 34557180 ~ 34564656 (-) False G1731156
TU1982734 other upstream 558909 34561169 ~ 34565175 (-) True G1731156

Expression Profile


TU1981956 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU1981956 Expression in each Bioproject

Bar chart with 14 bars.
TU1981956 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.