RNA id: TU1984063



Basic Information


Item Value
RNA id TU1984063
length 444
lncRNA type antisense_over
GC content 0.42
exon number 2
gene id G1732338
representative False

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 35685557 ~ 35735970 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTTCACATTGAGAAACACTGGACTCAAACTTAAAATTGAGGAATACTATGGACAGTTACACCATTTGAGTCAGGACACTAAACATATTTCAATTATTTTAATGTTGCAGTACAAATACACATTTACTTAGATTTTTGACTCTGTGCCTGTGCTTTAAGGACCTTGACAACGATCTTCTGCTCCTCAATCAGGAAAGCACGCTTGATCTATCACGTACACACTTCGCACACATGGCACCGCCGTAGGCCCTGCTGACGTGCTTCTTTGTCTTTGAGAGCCTCATCAGGACCTGGGGTCTCACTGCCCGGATCTTTAAGACAAACAAATGCTTGTGAGCAGATGTAACAAAACCTGAACCCAGGTTAATGTTCAGGAGAAACATGGGAGAAACCATTTTGAAACAAAGTGAAATGCCACAGCCATTGTTAAAGGAGAAGTTCACTT

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1984059 lncRNA upstream 34760 35683917 ~ 35684172 (+) True G1732336
TU1984057 lncRNA upstream 35836 35682873 ~ 35683096 (+) True G1732334
TU1984056 lncRNA upstream 36188 35682476 ~ 35682744 (+) True G1732333
TU1984047 lncRNA upstream 43176 35675549 ~ 35675756 (+) True G1732324
TU1984046 lncRNA upstream 43427 35675191 ~ 35675505 (+) True G1732323
TU1984064 lncRNA downstream 7213 35733241 ~ 35735257 (+) True G1732338
TU1984206 lncRNA downstream 140066 35866094 ~ 35883752 (+) True G1732467
TU1984472 lncRNA downstream 259939 35985967 ~ 35986270 (+) True G1732722
TU1984845 lncRNA downstream 808806 36534834 ~ 36549893 (+) True G1733069
TU1984871 lncRNA downstream 848308 36574336 ~ 36576894 (+) True G1733094
XR_005038438.1 mRNA upstream 81794 35636587 ~ 35637138 (+) True LOC118942786
NM_001165066.2 mRNA upstream 208811 35503691 ~ 35510121 (+) False sh2d1ab
XM_021577600.2 mRNA upstream 451132 35071370 ~ 35267800 (+) True LOC110500296
XM_021577598.2 mRNA upstream 685516 35029259 ~ 35033416 (+) True LOC110500295
XM_036956493.1 mRNA upstream 787761 34917692 ~ 34931171 (+) True LOC110501070
XM_021577628.2 mRNA downstream 62463 35788491 ~ 35982905 (+) False LOC110500322
XM_021577626.2 mRNA downstream 62464 35788492 ~ 35982905 (+) False LOC110500322
XM_021577627.2 mRNA downstream 62464 35788492 ~ 35982905 (+) True LOC110500322
XM_021577629.2 mRNA downstream 273793 35999821 ~ 36039069 (+) True sepsecs
XM_021577630.2 mRNA downstream 332088 36058116 ~ 36094464 (+) True lgi2a
TU1983724 other upstream 234578 35439289 ~ 35484354 (+) True G1732028
TU1981477 other upstream 1849955 33710092 ~ 33868977 (+) False LOC110500285
TU1980944 other upstream 2397171 33321453 ~ 33321761 (+) True G1729465
TU1979380 other upstream 3556540 32157912 ~ 32162392 (+) True LOC110500252
TU1979348 other upstream 3582236 32135955 ~ 32136696 (+) False LOC110501063
TU1984485 other downstream 315303 36041331 ~ 36042488 (+) True G1732735
TU1984576 other downstream 507094 36233122 ~ 36236265 (+) True LOC110500325
TU1984969 other downstream 1030961 36756989 ~ 36758883 (+) False G1733187
TU1986149 other downstream 1522599 37248627 ~ 37252175 (+) False zgc:109889
TU1986313 other downstream 1644929 37370957 ~ 37371667 (+) True G1734420

Expression Profile


TU1984063 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU1984063 Expression in each Bioproject

Bar chart with 15 bars.
TU1984063 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.