RNA id: TU1986323



Basic Information


Item Value
RNA id TU1986323
length 216
lncRNA type inter_gene
GC content 0.47
exon number 1
gene id G1734427
representative True

Chromosome Information


Item Value
chromosome id NC_048585.1
NCBI id CM023239.2
chromosome length 64935962
location 37392505 ~ 37392720 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tctgtctgtctttatgtctctgtctgtctctctctgtctgtttttttctctctctgtctgtctctctgtctatctctgtctggctctgtctttctgtctgtctgtctgtctgtccgtctctgtgtctgtctctctctgtctgtgtttttctctctctgtctgtctgtctgtctctctctgtctgtctgtctgtctgtctgtctgtctgtctgtctg

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1986321 lncRNA upstream 15224 37376957 ~ 37377281 (+) True G1734425
TU1986320 lncRNA upstream 15646 37376629 ~ 37376859 (+) True G1734424
TU1986303 lncRNA upstream 33850 37358177 ~ 37358655 (+) True G1734411
TU1986142 lncRNA upstream 78212 37308773 ~ 37314293 (+) False zgc:109889
TU1986143 lncRNA upstream 78212 37308773 ~ 37314293 (+) True zgc:109889
TU1986331 lncRNA downstream 13849 37406569 ~ 37406822 (+) True G1734435
TU1986357 lncRNA downstream 67835 37460555 ~ 37461176 (+) True G1734461
TU1986373 lncRNA downstream 152429 37545149 ~ 37550449 (+) False G1734477
TU1986374 lncRNA downstream 152429 37545149 ~ 37550449 (+) True G1734477
TU1986375 lncRNA downstream 159397 37552117 ~ 37553314 (+) True G1734478
XM_036957729.1 mRNA upstream 81265 37248296 ~ 37311240 (+) False zgc:109889
XM_036957730.1 mRNA downstream 38076 37430796 ~ 37537824 (+) False si:dkey-172j4.3
XM_036957732.1 mRNA downstream 38097 37430817 ~ 37537824 (+) False si:dkey-172j4.3
XM_036957731.1 mRNA downstream 38464 37431184 ~ 37537824 (+) False si:dkey-172j4.3
XM_036957733.1 mRNA downstream 91911 37484631 ~ 37537824 (+) True si:dkey-172j4.3
XM_021577614.2 mRNA downstream 256782 37649502 ~ 37656152 (+) False LOC110500311
TU1986313 other upstream 20838 37370957 ~ 37371667 (+) True G1734420
TU1986149 other upstream 140330 37248627 ~ 37252175 (+) False zgc:109889
TU1984969 other upstream 633622 36756989 ~ 36758883 (+) False G1733187
TU1984576 other upstream 1156240 36233122 ~ 36236265 (+) True LOC110500325
TU1984485 other upstream 1350017 36041331 ~ 36042488 (+) True G1732735
TU1986376 other downstream 172708 37565428 ~ 37568953 (+) True G1734479
TU1986710 other downstream 367615 37760335 ~ 37763258 (+) False cited1
TU1986951 other downstream 650371 38043091 ~ 38045066 (+) False G1734960
TU1986954 other downstream 652388 38045108 ~ 38046506 (+) True G1734961
TU1986976 other downstream 684831 38077551 ~ 38082274 (+) True LOC110500301

Expression Profile


TU1986323 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU1986323 Expression in each Bioproject

Bar chart with 8 bars.
TU1986323 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.